Corinnomma semiglabrum

(Simon, 1896) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Corinnidae/Corinnomma

At a glance

Occurrence records13

Data sources7

Biological traits30

DNA specimens9

eDNA detections2

Sources7 archives

Databases and archives Corinnomma semiglabrum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility13 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

World Spider Trait DBMasaryk University30 traits · 3 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources30 traits

Occurrence & distributionGBIF13 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD9 specimens

01Narrative

Corinnomma semiglabrum is een spinnensoort uit de familie van de loopspinnen (Corinnidae). De wetenschappelijke naam van de soort werd in 1896 als Apochinomma semiglabrum gepubliceerd door Eugène Simon.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPekár 2014bPekár 2014aHaddad 2006

Morphometry28

Abdomen length♀3.6·♂2.6 mm

Body length♀6.5·♂5.25 mm

Cephalothorax length♀2.9·♂2.65 mm

Cephalothorax width♀1.9·♂1.79 mm

Femur I length♀2.3·♂2 mm

Femur II length♀2.05·♂1.8 mm

Femur III length♀1.95·♂1.85 mm

Femur IV length♀2.45·♂2.8 mm

Leg I length♀8.68·♂8.24 mm

Leg II length♀7.65·♂6.8 mm

Leg III length♀6.8·♂6.7 mm

Leg IV length♀8.98·♂10.52 mm

Metatarsus I length♀1.93·♂1.85 mm

Metatarsus II length♀1.65·♂1.55 mm

Metatarsus III length♀1.75·♂1.75 mm

Metatarsus IV length♀2.55·♂3.05 mm

Patella I length♀0.9·♂0.7 mm

Patella II length♀1·♂0.75 mm

Patella III length♀0.9·♂0.8 mm

Patella IV length♀0.9·♂0.97 mm

Tarsus I length♀1.3·♂1.54 mm

Tarsus II length♀1.2·♂1.05 mm

Tarsus III length♀0.85·♂0.8 mm

Tarsus IV length♀0.83·♂1.2 mm

Tibia I length♀2.25·♂2.15 mm

Tibia II length♀1.75·♂1.65 mm

Tibia III length♀1.35·♂1.5 mm

Tibia IV length♀2.25·♂2.5 mm

Ecology1

Circadian activitydiurnal

Defence1

Primary defenceBatesian mimicry

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Corinnomma semiglabrum has left across the world's sequence archives.

At a glance

DNA specimens9

BINs1

Marker genes1

eDNA detections2

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.46%

Haplotypes2

BIN1

Most divergent pair0.30%

Where individuals differ — all 7 variable positions, in barcode order

43Amostly conserved

46Gmostly conserved

283Gmostly conserved

287Tmostly conserved

289Gmostly conserved

313Gmostly conserved

469Tmostly conserved

AACTTTGTATTTAATATTTGGAGCTTGAGCGGCTATAGTGGGAACGGCTATAAGAGTTTTAATTCGTTTGGAATTAAGACAGATTGGTAG …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Merenius albertisame family11.6%Coenoptychus tropicalissame family11.6%Asemonea clarasame order13.8%Patrera procerasame order14.1%Nycerella decoratasame order14.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type13 records

Wild obs. + sensor4

Museum / vouchered9

Range

Area of Occupancy AOO48 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 3≤1 km 1

4 georeferenced

Open the mapobservation + sensor4

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 9 records without

Open the institutions mapphysical evidence9

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Museum, Bloemfonteinlocation not on record	3
Royal Museum for Central Africalocation not on record	2
National Collection of Arachnida, South Africalocation not on record	2
Cape Town, ZA	1
Agricultural Research Council, Plant Protection Research Institute, National Collection of Arachnidalocation not on record	1

5 institutions · 9 of 9 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Corinnomma semiglabrum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

Savanna

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.4 °C 23.6–25.1

Seasonal swing summer↔winter9.70 °C

Max temp (day)29.3 °C 28.7–29.8

Min temp (night)19.2 °C 18.1–20.3

Precipitation108 mm/mo 103–113

Air humidity57.8 % 56.1–59.4

Moisture balance-60.6 mm/mo -61.7–-59.4

Vapour deficit1,288 Pa 1,283–1,293

Wind speed2.50 m/s 2.30–2.80

Cloud cover37.8 % 37.4–38.1

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)