Corimelaena pulicaria

(Germar, 1839) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Thyreocoridae/Corimelaena

At a glance

Occurrence records687

Data sources6

Biological traits0

DNA specimens21

eDNA detections18

Sources6 archives

Databases and archives Corimelaena pulicaria's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility687 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI18 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics21 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF687 records

Environmental DNA1 datasets · 1 countries18 detections

DNA & barcodingBOLD21 specimens

01Narrative

Corimelaena pulicaria, the black bug, is a species of ebony bug in the family Thyreocoridae. It is found in Central America and North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding21 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Corimelaena pulicaria has left across the world's sequence archives.

At a glance

DNA specimens21

BINs1

Marker genes1

eDNA detections18

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus13 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.20%

Haplotypes1

BIN1

Where individuals differ — all 7 variable positions, in barcode order

76Gmostly conserved

88Amostly conserved

89Amostly conserved

100Amostly conserved

241Tmostly conserved

271Tmostly conserved

340Tmostly conserved

AACATTATACTTCTTATTTGGAATATGAGCCGGAATAGTAGGAACAGCAATAAGATGAATCATTCGAGTAGAATTGGGTCAACCTGGAAC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Corimelaena nigrasame genus10.8%Corimelaena lateralissame genus11.1%Corimelaena incognitasame genus11.6%Eurydema geblerisame order12.3%Galgupha ovalissame family12.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type687 records

Wild obs. + sensor60

Museum / vouchered627

Range

Area of Occupancy AOO856 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 30≤1 km 10≤10 km 3>10 km 5

48 georeferenced · 12 without coordinates

Open the mapobservation + sensor60

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy16% within 1 km

≤100 m 6≤1 km 46≤10 km 278

330 georeferenced · 297 without coordinates

Open the institutions mapphysical evidence627

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Champaign, US	307
Mississippi State, US	158
Royal Saskatchewan Museumlocation not on record	42
University of Guelphlocation not on record	33
WIlocation not on record	21
Natural History Museum of Utahlocation not on record	18
Vancouver, CA	17
Lubbock, US	4
University of Guelph, Centre for Biodiversity Genomicslocation not on record	3
Universidad Católica de Manizaleslocation not on record	3
University of Central Floridalocation not on record	3
Cambridge, US	2
Cornell University Insect Collectionlocation not on record	2
North Carolina State University Insect Museumlocation not on record	2
CUlocation not on record	1
Washington, US	1

16 institutions · 617 of 627 vouchered records shown · 10 without an institution code

09Environmental DNA18 detections

Where the DNA of Corimelaena pulicaria was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found18

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 18 detections have coordinates

Open the map1 country0

farmGrassland1. Forest & Woodland|1.1 Boreal Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.0 °C 10.2–19.7

Seasonal swing summer↔winter28.1 °C

Max temp (day)18.8 °C 13.4–26.9

Min temp (night)9.80 °C 7.80–14.0

Precipitation82.1 mm/mo 49.6–113

Air humidity57.0 % 51.8–57.4

Moisture balance-24.5 mm/mo -124–-16.9

Vapour deficit704 Pa 537–1,112

Wind speed2.70 m/s 2.30–4.00

Cloud cover44.3 % 34.5–46.3

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)