Coriandrum sativum
speciesAt a glance
Occurrence records12 279
Data sources18
Biological traits64
DNA specimens34
eDNA detections61
Sources18 archives
Databases and archives Coriandrum sativum's data was compiled from.
WikipediaWikimedia Foundation21 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility12 279 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI61 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics34 specimens↗
NCBIUS National Library of Medicinesequences↗
dukesphytochemcompounds
FooDBThe Metabolomics Innovation Centrecompounds↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources64 traits
Chemical compositionDukesPhytochem · FooDB · LOTUS · NPASS6 146 compounds
Occurrence & distributionGBIF12 279 records
Environmental DNA3 datasets · 5 countries61 detections
DNA & barcodingBOLD · NCBI34 specimens
Genome at a glanceCCDB · GIFT · GoaT2.3 Gbp
01Narrative
Coriander (;coriander in the Cambridge English Pronouncing Dictionary Coriandrum sativum) is an annual herb in the family Apiaceae. It is also known as Chinese parsley, dhania, or cilantro ().cilantro in the Cambridge English Pronouncing Dictionary All parts of the plant are edible, but the fresh leaves and the dried seeds (which are both an herb and a spice) are the parts most traditionally used in cooking. Most people perceive coriander as having a tart, lemon/lime taste, but to nearly a quarter of those surveyed, the leaves taste like dish soap, linked to a gene that detects some specific aldehydes that can produce soapy sensation from the odorant substances.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology23
Fruit length3.75 mm
⚠ sources differ — AusTraits: 3.75 mm · GIFT: 5.5 mm
Fruit length max6 mm
Fruit length min6 mm
Fruit width1.5 mm
Fruit width max1.5 mm
Fruit width min1.5 mm
Inflorescence length max3 cm
Inflorescence length min2 cm
Leaf length13 mm
⚠ sources differ — AusTraits: 13 mm · GIFT: 7.5 mm
Leaf length max150 mm
Leaf length min5 mm
Leaf mass24.12 mg
Leaf size1 167 mm²
Leaf width32.5 mm
Leaf width max100 mm
Leaf width min0.5 mm
Plant height0.393 m
⚠ sources differ — GIFT: 0.393 m · AusTraits: 0.55 m · LEDA: 0.46 m · TRY: 0.504 m
Plant height generative0.53 m
Plant height max0.75 m
Plant height min0.125 m
Seed mass9.49 mg
⚠ sources differ — TRY: 9.49 mg · LEDA: 9.45 mg · GIFT: 7.07 mg
Seed mass max10.4 mg
Seed mass min1.94 mg
Life cycle & reproduction17
Deciduousnessevergreen
Dispersal typeanimal
⚠ sources differ — LEDA: epizoochor · GIFT: unspecialized
Flower colourwhite
Flower length max4 mm
Flower length min3 mm
Flowering endJul
Flowering startJun
Life formannual
Life spanannual
Lifespan years1 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formtherophyte
Reproduction asexualabsent
Seed number1 224
Self fertilizationpresent
Sex typehermaphrodite
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment14
Aquaticterrestrial
Climatesubtropical
Climberself-supporting
Elevation max1 775 m
Elevation min100 m
Epiphyteterrestrial
Fruit typemericarp
Growth formherb
Habitat GIFTLowland
Leaf compoundnesscompound
Leaf formlinear
Leaf shapeoblong ovate
Mycorrhiza type3.81E-17
Woodinessnon-woody
Physiology & chemistry4
Leaf dry-matter content (LDMC)142 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Specific leaf area (SLA)47.38 mm²/mg
Other traits4
Diaspore typefruit
Inflorescenceumbel
Seeds per fruit101-1000
Shoot orientationerect
03Chemical composition6 146 compounds
Compounds documented for Coriandrum sativum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cookingHerbs and Spices
Compound class profile5 classes
Aminoacids84
Cinnamic acids and derivatives65
Fatty aldehydes57
Glycerophospholipids57
Acyclic monoterpenoids55
Documented compounds6 146 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| LINALOOL | 742,300 ppm | DukesPhytochem | |
| PETROSELINIC-ACID | 718,000 ppm | DukesPhytochem | |
| CARBOHYDRATES | 603,240 ppm | DukesPhytochem | |
| CUMINALDEHYDE | 480,000 ppm | DukesPhytochem | |
| P-MENTHA-1,4-DIEN-7-AL | 319,800 ppm | DukesPhytochem | |
| FIBER | 319,000 ppm | DukesPhytochem |
05DNA & barcoding34 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Coriandrum sativum has left across the world's sequence archives.
At a glance
DNA specimens34
Marker genes8
GenBank sequences10
eDNA detections61
Countries9
The DNA barcodea real sequence read deposited for this species
TATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACG …
Coriandrum sativum isolate NRCL1 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK1★rbcL4★rbcLa★ITS5★ITS1★ITS2trnH-psbA
animal barcodeplant barcodefungal barcodemarker
06Genome at a glanceCCDB · GIFT · GoaT
The complete instruction manual Coriandrum sativum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size2 268 960 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Coriandrum sativum2.27 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 22 n = 11
Ploidy2× diploid · measured
Chromosome records14–442n range22median22mode59records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2231×GoaT · Kew Plant DNA C-values Database · CCDB · iber-fl · CCDB · nw-europe-fl +9
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. Queirs, M.Anurio Soc. Brot.38: 293(1972).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3247
CCDB · fl-europaea — Garde & Malheiros-
CCDB · book-ipcn65 — Joshi & R. 1965
CCDB · ipcn-api-dl — Li, R. q. 1989. Studies on Karyotypes of Vegetables in China
CCDB · ipcn-api-dl — Hamal, I. A., A. LANGER & A. K. Koul. 1986. Nucleolar organizing region in the Apiaceae (Umbelliferae). Pl. Syst. Evol. 154: 11–30.
CCDB · ipcn-api-dl — Rostovtseva, T. S. 1984. Khrom. Chisla Tsvet. Nauka, Novosibirsk.
CCDB · ipcn-api-dl — Rostovtseva, T. S. 1982. The chromosome numbers of some species of the family Apiaceae. III. Bot. Zhurn. SSSR 67 (2): 206–210. (In Russian).
CCDB · ipcn-api-dl — Subramanian, D. 1986. Cytotaxonomical studies in south Indian Apiaceae. Cytologia 51: 479–488.
CCDB · ipcn-api-dl — Das, A. & R. Mallick. 1989. Karyotype analysis in different varieties of Coriandrum sativum L. Curr. Sci. 58: 73–75.
CCDB · ipcn-api-dl — Das, A. & R. Mallick. 1989. Variation in 4C DNA content and chromosome characteristics in different varieties of Coriandrum sativum L. Cytologia 54: 609–616.
CCDB · ipcn-api-dl — Krishnappa, D. G. & A. N. Basappa. 1988. SOCGI plant chromosome number reports -- VI. J. Cytol. Genet. 23: 38–52.
CCDB · ipcn-api-dl — Zhao, Z. f., Y. q. Wang & S. f. Huang. 1990. Plant chromosome counts (V). Forest Res. (China) 3: 503–508.
CCDB · ipcn-api-dl — Stepanov, N. V. & E. N. Muratova. 1995. Chromosome numbers of some taxa of higher plants of Krasnoyarsk territory. Bot. Žhurn. (Moscow & Leningrad) 80(6): 114–116.
CCDB · ipcn-api-dl — Sarkar, A. K., N. DATTA & U. Chatterjee. 1980a. In Chromosome number reports LXVII. Taxon 29: 360–361.
CCDB · ipcn-api-dl — Queiros, M. 1978. Numeros cromosomicos para a flora Portuguesa 1-15. Bol. Soc. Brot., sér. 2 52: 69–77.
CCDB · ipcn-api-dl — Sharma, A. K. 1970. Annual report, 1967-1968. Res. Bull. Univ. Calcutta Cytogenetics Lab. 2: 1–50.
CCDB · ipcn-api-dl — HINDAKOVA, M. 1978. In Index of chromosome numbers of Slovakian flora. Part 6. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 26: 1–42.
CCDB · ipcn-api-dl — Chattopadhyay, D. & A. K. Sharma. 1990. Chromosome studies and microspectrophotometric estimation of nuclear DNA in different strains of Coriandrum sativum L. Cytobios 64(256): 45–51.
CCDB · book-ipcn73-74 — BAIJAL, S.K., & B.K. KAUL. 1973. Karyomorphological studies in Coriandrum sativum L. and Cuminum cyminum L. Cytologia 38: 211-217.
CCDB · book-indian_vol1 — Wanscher, J.H. 1932 ; Tamamshjan, S. (Fedorov); Delay, C. 1947; Garde, A._ & Malheiros-Garde, N. 1949, 1954 ; Suzuka, O. 1952-1953, 1956; Hakans- son, A. 1953 ; Sharma, A.K. & Ghosh, C. 1954a ; Sharma, A.K. & Datta. P.C. 1957 ; Sharma, A.K. & Bhattacharyya, N.K. 1959b; Bell, C.R. & Constance, L. 1960, 1966 ; Kordyum, E.L. 1967 ; Baijal, S.K. & Kaul, B.K. 1973 ; Ahmad, I. & Koul, A.K. 1980; Sarkar, A.K., Datta, N. & Chatterjee, U. 1980
CCDB · book-indian_vol1 — Hore, A. 1977d
CCDB · book-atlas-flowering-plants — Garde & G. 1949
CCDB · Cave1956supp — Suzuka 1952-3
CCDB · CromoCat 2015 — Ahmad, I. & Koul, A. K. (1980). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXVIII]. Taxon 29(4): 543.
CCDB · CromoCat 2015 — Gabrielan, E. & Zohary, D. (2004). Wild relatives of food crops native to Armenian and Nakhichevan Fl. Medit. 14: 5-80
CCDB · CromoCat 2015 — Hore, A. (1976a). Study of the structure and behaviour of chromosomes of different agricultural strains of Coriandrum sativum (coriander) Proc. Indian Sci. Congr. Assoc. 63: 117
CCDB · CromoCat 2015 — Hore, A. (1977a). An improved technique for the karyotype study of an economically important family Umbelliferae Curr. Sci. 46: 751–752
CCDB · CromoCat 2015 — Queirós, M. (1972). Contribuiçao para o conhecimento citotaxonómico das Spermatophyta de Portugal. Anuário Soc. Brot. 38: 293.
GIFT · GIFT (floras)
2n 1418×CCDB · iber-fl · CCDB · nw-europe-fl · CCDB · ipcn-api-dl +4
CCDB · iber-fl — Chromosome atlas of flowering plants. Darlintong, C. D. & A. P. Wylie.*(1955).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3282
CCDB · ipcn-api-dl — Hamal, I. A., A. LANGER & A. K. Koul. 1986. Nucleolar organizing region in the Apiaceae (Umbelliferae). Pl. Syst. Evol. 154: 11–30.
CCDB · ipcn-api-dl — Cauwet-Marc, A. M. 1982. In: IOPB chromosome number reports LXXVII. Taxon 31: 771–772.
CCDB · ipcn-api-dl — Jha, S. & S. SEN. 1983. Chromosome study of diploid Indian squill, Urginea indica Kunth. Cytologia 48: 79–86.
CCDB · ipcn-api-dl — Krishnappa, D. G. & A. N. Basappa. 1988. SOCGI plant chromosome number reports -- VI. J. Cytol. Genet. 23: 38–52.
CCDB · ipcn-api-dl — Chattopadhyay, D. & A. K. Sharma. 1990. Chromosome studies and estimation of nuclear DNA in different varieties of Cuminum cyminum L. and Carum copticum Benth. and Hook. Cytologia 55: 631–637.
CCDB · ipcn-api-dl — Sheidai, M., P. Ahmadian & S. Poorseyedy. 1996. Cytological studies in Iran Zira from three genera: Bunium, Carum and Cuminum. Cytologia 61: 19–25.
CCDB · ipcn-api-dl — Ahmad, I. & A. K. Koul. 1980. In Chromosome number reports LXVIII. Taxon 29: 543.
CCDB · ipcn-api-dl — Carbonnier, J. & M. Farille. 1980. Contribution a l'etude caryologique des Ombelliferes du Nepal. I. Candollea 35:497–510.
CCDB · ipcn-api-dl — HORE, A. 1980. Structure and behaviour of chromosomes as an aid to the study of phylogeny of Umbelliferae with special reference to the tribe Apieae (Ammineae) and Saniculeae. Cytologia 45: 389–402.
CCDB · ipcn-api-dl — Das, A. B. & R. Mallick. 1993. Nuclear DNA and chromosome changes within the tribe Amminae. Cytobios 74(298–299): 197–207.
CCDB · ipcn-api-dl — Ghaffari, S. M. 2006. New or rare chromosome counts of some angiosperm species from Iran. Iran. J. Bot. 11(2): 185–192.
CCDB · ipcn-api-dl — Das, A. B. 1991. Genome analysis and variation of 4C DNA content in the subtribe Carinae. Cytologia 56: 627–632.
CCDB · book-ipcn73-74 — BAIJAL, S.K., & B.K. KAUL. 1973. Karyomorphological studies in Coriandrum sativum L. and Cuminum cyminum L. Cytologia 38: 211-217.
CCDB · book-indian_vol1 — Sharma, A.K. & Ghosh, C. l954a; Baijal, S.K. & Kaul, B. K. 1973 ; Ahmad, I. & Koul, A.K. 1980 ; Hore, A. 1980
CCDB · book-fedorov — Sharma A. K., Ghosh 1954a plat
CCDB · book-atlas-flowering-plants — Sharma & G. 1954
2n 244×CCDB · ipcn-api-dl · CCDB · book-indian_vol1 · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Husain, Z. & M. A. Padhya. 1992. In vitro propagation of Cuminum cyminum L. through somatic embryogenesis. Proc. Indian Sci. Congr. Assoc. 79(3:VIII): 137.
CCDB · book-indian_vol1 — Hore, A. 1977d
CCDB · CromoCat 2015 — Hore, A. (1976a). Study of the structure and behaviour of chromosomes of different agricultural strains of Coriandrum sativum (coriander) Proc. Indian Sci. Congr. Assoc. 63: 117
CCDB · CromoCat 2015 — Hore, A. (1977a). An improved technique for the karyotype study of an economically important family Umbelliferae Curr. Sci. 46: 751–752
2n 282×CCDB · CromoCat 2015 · GIFT · GIFT (floras)
CCDB · CromoCat 2015 — Hore, A. (1976a). Study of the structure and behaviour of chromosomes of different agricultural strains of Coriandrum sativum (coriander) Proc. Indian Sci. Congr. Assoc. 63: 117
GIFT · GIFT (floras)
2n 181×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Subramanian, D. 1986. Cytotaxonomical studies in south Indian Apiaceae. Cytologia 51: 479–488.
2n 231×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Hore, A. (1976a). Study of the structure and behaviour of chromosomes of different agricultural strains of Coriandrum sativum (coriander) Proc. Indian Sci. Congr. Assoc. 63: 117
2n 251×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Hore, A. (1976a). Study of the structure and behaviour of chromosomes of different agricultural strains of Coriandrum sativum (coriander) Proc. Indian Sci. Congr. Assoc. 63: 117
2n 261×GIFT · GIFT (floras)
GIFT · GIFT (floras)
2n 301×GIFT · GIFT (floras)
GIFT · GIFT (floras)
2n 441×CCDB · book-indian_vol1
CCDB · book-indian_vol1 — Biswas, A.K. & Chatterji, A.K. 1971
n 1114×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · book-ipcn66 +3
CCDB · iber-fl — Contribuiao para o estudo cariolgico da familia Umbelliferae. I Gard, A. & N. Malheiros-Gard.Agron. Lusit.11(2): 91-140(1949).
CCDB · ipcn-api-dl — Krishnappa, D. G. & A. N. Basappa. 1988. SOCGI plant chromosome number reports -- VI. J. Cytol. Genet. 23: 38–52.
CCDB · ipcn-api-dl — Khatoon, S. & S. I. Ali. 1993. Chromosome Atlas of the Angiosperms of Pakistan. Department of Botany, University of Karachi, Karachi.
CCDB · ipcn-api-dl — Sharma, A. K. 1970. Annual report, 1967-1968. Res. Bull. Univ. Calcutta Cytogenetics Lab. 2: 1–50.
CCDB · ipcn-api-dl — FUTEHALLY, S. & A. A. VAHIDY. 1974. Variation among five varieties of coriander, Coriandrum sativum L. Pakistan J. Bot. 6: 109–115.
CCDB · ipcn-api-dl — Koul, A. K., A. K. Wakhlu & J. L. KARIHALOO. 1976a. Chromosome numbers of some flowering plants of Jammu (western Himalayas). II. CIS Chromosome Inform. Serv. 20: 32–33.
CCDB · book-ipcn66 — Bell&Constance 1966
CCDB · book-ipcn67-71 — KORDYUM, E. L. 1967. Cyto-embryology of Umbellates. (In Russian). Naukova Dumka, Kiev, 1967, 128pp.
CCDB · Cave1956supp — Garde & M,-Garde 1954
CCDB · CromoCat 2015 — Gardé, A. & Malheiros-Gardé, N. (1949). Contribuiçao para o estudo cariológico da familia Umbelliferae. I. Agron. Lusit. 11(2): 91-140.
CCDB · CromoCat 2015 — Khatoon, S. & Ali, S. I. (1993). Chromosome Atlas of the Angiosperms of Pakistan. Department of Botany, University of Karachi, Karachi
CCDB · CromoCat 2015 — Koul, A. K., Wakhlu, A. K. & Karohaloo, J. L. (1976a). Chromosome numbers of some flowering plants of Jammu (western Himalayas). II. CIS Chromosome Inform. Serv. 20: 32–33
CCDB · CromoCat 2015 — Sarkar, A. K., N. Datta & U. Chatterjee. (1980b). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXVII]. Taxon 29(2/3): 360-361.
CCDB · CromoCat 2015 — Sharma, A. K. (1970). Annual report, 1967-1968 Res. Bull. Univ. Calcutta (Cytogenetics Lab.) 2: 1-50
n 74×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Krishnappa, D. G. & A. N. Basappa. 1988. SOCGI plant chromosome number reports -- VI. J. Cytol. Genet. 23: 38–52.
CCDB · ipcn-api-dl — Khatoon, S. & S. I. Ali. 1993. Chromosome Atlas of the Angiosperms of Pakistan. Department of Botany, University of Karachi, Karachi.
CCDB · ipcn-api-dl — HORE, A. 1980. Structure and behaviour of chromosomes as an aid to the study of phylogeny of Umbelliferae with special reference to the tribe Apieae (Ammineae) and Saniculeae. Cytologia 45: 389–402.
CCDB · ipcn-api-dl — Ghaffari, S. M. 2006. New or rare chromosome counts of some angiosperm species from Iran. Iran. J. Bot. 11(2): 185–192.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · family-scale
PloiDB · family-scale — chromEvol; reliability=0.960 ↗
07Deep time~21.9 Ma lineage
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
DNA clock origin21.9 Ma TimeTree
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.
DNA clock origin
08Occurrence & distribution
Record type12 279 records
Wild obs. + sensor9 173
Museum / vouchered2 842
Cultivated / captive161
Other103
Origin
Native9
Introduced477
Range
Area of Occupancy AOO34 116 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy70% within 1 km
≤100 m 4 488≤1 km 700≤10 km 2 086>10 km 143
7 417 georeferenced · 1 756 without coordinates
Open the mapobservation + sensor9 173
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy61% within 1 km
≤100 m 306≤1 km 362≤10 km 294>10 km 126
1 088 georeferenced · 1 754 without coordinates
Open the institutions mapphysical evidence2 842
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy11% within 1 km
≤1 km 3≤10 km 20>10 km 5
28 georeferenced · 133 without coordinates
Open the mapnot free-living161
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions201 of 366 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Beijing, CN | 90 |
| LDlocation not on record | 88 |
| Chapingo, MX | 86 |
| Chengdu, CN | 82 |
| Nanjing, CN | 76 |
| QAUlocation not on record | 75 |
| Yangling, CN | 66 |
| Saint Louis, US | 65 |
| Helsinki, FI | 64 |
| Durango, MX | 61 |
| Moscow State Universitylocation not on record | 61 |
| SLU Artdatabankenlocation not on record | 49 |
| Baroda, IN | 48 |
| Guangzhou, CN | 44 |
| MeiseBGlocation not on record | 44 |
| CICYTEXlocation not on record | 42 |
| BFLlocation not on record | 36 |
| Olocation not on record | 32 |
| Oskarshamn, SE | 31 |
| Kunming, CN | 29 |
| ROM007location not on record | 24 |
| BRNUlocation not on record | 23 |
| Mexico City, MX | 23 |
| Bronx, US | 22 |
| Philadelphia, US | 21 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 20 |
| CJBGlocation not on record | 20 |
| Adam Mickiewicz University in Poznańlocation not on record | 19 |
| Philadelphia, US | 19 |
| Austin, US | 18 |
| Rishon Le Zion, IL | 18 |
| UChlocation not on record | 17 |
| ROM020location not on record | 17 |
| Trondheim, NO | 17 |
| South Kensington, GB | 17 |
| Puebla, MX | 17 |
| Guilin, CN | 17 |
| Tapachula, MX | 17 |
| Sanda, JP | 16 |
| Taipei, TW | 15 |
| Córdoba, AR | 14 |
| Auckland, NZ | 14 |
| Zhengzhou, CN | 14 |
| Görlitz, DE | 14 |
| Universidad de Antioquia (UdeA)location not on record | 14 |
| Odawara, JP | 14 |
| Oulu, FI | 13 |
| Canadian Department of Agriculturelocation not on record | 13 |
| Riverside, US | 13 |
| Tartu, EE | 12 |
| Provincia di Livornolocation not on record | 12 |
| Bern, CH | 12 |
| San Diego, US | 11 |
| Guatemala, GT | 11 |
| Guiyang, CN | 11 |
| Porrentruy, CH | 11 |
| Brisbane, AU | 10 |
| BClocation not on record | 10 |
| Puerto Ayora, EC | 10 |
| 盐城国家级珍禽自然保护区location not on record | 10 |
| Mlocation not on record | 10 |
| Mount Annan, AU | 9 |
| TROMlocation not on record | 9 |
| Brussel, BE | 9 |
| ASUlocation not on record | 9 |
| Xinxiang, CN | 9 |
| Fort Worth, US | 9 |
| Tepatitlán de Morelos, MX | 9 |
| MAlocation not on record | 9 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 8 |
| KR | 8 |
| BIO-UNIPIlocation not on record | 8 |
| Santa Barbara, US | 8 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 8 |
| Christchurch, NZ | 8 |
| Barcelona, ES | 8 |
| BDBClocation not on record | 8 |
| Kuopio, FI | 8 |
| Xining, CN | 8 |
| Berlin, DE | 8 |
| GMBAlocation not on record | 7 |
| Nijmegen, NL | 7 |
| Uppsala, SE | 7 |
| Wuhan, CN | 7 |
| Adelaide, AU | 7 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 7 |
| Pondicherry, IN | 7 |
| Lanzhou, CN | 7 |
| Museo Entomologico de Leonlocation not on record | 6 |
| Paris, FR | 6 |
| Universidade Federal de Juiz de Foralocation not on record | 6 |
| Laboratorio de Ictiologialocation not on record | 6 |
| Bergen, NO | 6 |
| Mérida, MX | 6 |
| Pretoria, ZA | 6 |
| Salzburg, AT | 6 |
| Shanghai, CN | 6 |
| Bloomington, US | 6 |
| Nagano City, JP | 6 |
| Davis, US | 6 |
| València, ES | 6 |
| Canberra, AU | 6 |
| Pullman, US | 6 |
| Universidad Industrial de Santander (UIS)location not on record | 5 |
| Hangzhou, CN | 5 |
| Universidad Nacional de Colombia (UNAL)location not on record | 5 |
| Universidad Católica de Oriente (UCO)location not on record | 5 |
| Universidad del Quindío (UniQuindío)location not on record | 5 |
| University of Stellenboschlocation not on record | 5 |
| WTUlocation not on record | 5 |
| Chongqing Museumlocation not on record | 5 |
| 云南省思茅市民族传统医药研究所location not on record | 5 |
| Claremont, US | 5 |
| Göteborg, SE | 5 |
| Tsukuba, JP | 5 |
| Corvallis, US | 5 |
| Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record | 5 |
| AZE015location not on record | 4 |
| Istituto Agrario Castelnuovolocation not on record | 4 |
| Stockholm, SE | 4 |
| Guatemala City, GT | 4 |
| Strecker Museum, Baylor Universitylocation not on record | 4 |
| Salvador, BR | 4 |
| Tuxtla Gutiérrez, MX | 4 |
| Durban, ZA | 4 |
| Entomological Society of Latvialocation not on record | 4 |
| Frankfurt am Main | 4 |
| Xiamen, CN | 4 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 4 |
| Mexico City, MX | 4 |
| Tampa, US | 4 |
| TAFORI-LSRClocation not on record | 4 |
| FJIDClocation not on record | 4 |
| EL PASO, US | 4 |
| Chengdu, CN | 4 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 4 |
| Vancouver, CA | 4 |
| Universidad de La Salle (La Salle)location not on record | 4 |
| Phoenix, US | 4 |
| Teresina, BR | 4 |
| Guiyang, CN | 3 |
| Honolulu, US | 3 |
| BAYLUlocation not on record | 3 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 3 |
| Uniwersytet Wrocławskilocation not on record | 3 |
| UFOPlocation not on record | 3 |
| TAIElocation not on record | 3 |
| Staten Island, US | 3 |
| BISHlocation not on record | 3 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 3 |
| Maringá, BR | 3 |
| Tianjin Natural History Museumlocation not on record | 3 |
| GZUlocation not on record | 3 |
| Sevilla, ES | 3 |
| Bourges, FR | 3 |
| Guangzhou, CN | 3 |
| Tallinn, EE | 3 |
| Kyoto Universitylocation not on record | 3 |
| Wuzhou, CN | 3 |
| Natural History Museum Rotterdamlocation not on record | 3 |
| Aarhus, DK | 3 |
| Sagamihara, JP | 3 |
| Juriquilla, MX | 3 |
| Dekalb, US | 3 |
| Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record | 3 |
| Chengdu, CN | 3 |
| Denver, US | 3 |
| ESP027location not on record | 3 |
| Masindi, UG | 3 |
| Wellington, NZ | 3 |
| DBF-NHMDlocation not on record | 3 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 3 |
| ESP026location not on record | 3 |
| College of the Atlantic, Museumlocation not on record | 3 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 3 |
| Foz do Iguaçu, BR | 3 |
| Burlington, US | 3 |
| Wuhan, CN | 3 |
| Austin, US | 3 |
| UFBAlocation not on record | 3 |
| Feira de Santana, BR | 3 |
| Shanxi Institute of Biologylocation not on record | 3 |
| UTPLlocation not on record | 3 |
| US | 2 |
| Fortaleza, BR | 2 |
| UEMlocation not on record | 2 |
| Albuquerque, US | 2 |
| San Francisco, US | 2 |
| Zürich, CH | 2 |
| UTFPR-CPlocation not on record | 2 |
| UNESP-FCAlocation not on record | 2 |
| Palacký University in Olomouclocation not on record | 2 |
| HUN003location not on record | 2 |
| Long Beach, US | 2 |
| Departamento de Sistematica e Ecologialocation not on record | 2 |
| BSBIlocation not on record | 2 |
| National Biodiversity Institute, Costa Ricalocation not on record | 2 |
| Edinburgh, GB | 2 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 2 |
| ISAlocation not on record | 2 |
| Hermosillo, MX | 2 |
| San Francisco de Campeche, MX | 2 |
| Rotorua, NZ | 2 |
| Mérida, MX | 2 |
| GB | 2 |
| Universidade Federal de Sergipe (UFS)location not on record | 2 |
| Turlock, US | 2 |
| San Isidro, AR | 2 |
| Centro de Estudios y Colecciones Biológicas para la Conservaciónlocation not on record | 2 |
| San José, CR | 2 |
| Pontifícia Universidade Católica do Paranálocation not on record | 2 |
| Porvoo, FI | 2 |
| Valparaiso, CL | 2 |
| Tromso University Museumlocation not on record | 2 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 2 |
| Hanshan Normal Universitylocation not on record | 2 |
| John May Museum of Natural Historylocation not on record | 2 |
| Central China Normal Universitylocation not on record | 2 |
| Calabar, NG | 2 |
| UNESClocation not on record | 2 |
| Little Rock, US | 2 |
| UnBlocation not on record | 2 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 2 |
| Kensington, AU | 2 |
| Seoul, KR | 2 |
| Corrientes, AR | 2 |
| Ciudad Autónoma de Buenos Aires, AR | 2 |
| Flagstaff, US | 2 |
| Nagatoro-machi, Chichibu-gun, JP | 2 |
| Ivano-Frankivsk, UA | 2 |
| Chiba, JP | 2 |
| National Institute for Agricultural and Veterinarian Research, Portugallocation not on record | 2 |
| Taipei, TW | 2 |
| University of New Hampshirelocation not on record | 2 |
| TUR-Alocation not on record | 2 |
| Northridge, US | 2 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 2 |
| Armidale, AU | 2 |
| UFPElocation not on record | 2 |
| Bend, US | 2 |
| McWane Science Centerlocation not on record | 2 |
| Appalachian State Universitylocation not on record | 2 |
| Santa Cruz, US | 2 |
| Universidade Federal do Rio Grande do Nortelocation not on record | 2 |
| PRClocation not on record | 2 |
| Anhui Normal Universitylocation not on record | 2 |
| Brasília, BR | 2 |
| Zacatecas, MX | 2 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 1 |
| University of Alberta Museumslocation not on record | 1 |
| National Institute of Biological Resourceslocation not on record | 1 |
| Québec, CA | 1 |
| Tuscaloosa, US | 1 |
| St. Paul, US | 1 |
| Acadia Universitylocation not on record | 1 |
| Universidad de Nariño (UdeNar)location not on record | 1 |
| Loja, EC | 1 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 1 |
| Uniwersytet Opolskilocation not on record | 1 |
| Antiguo Cuscatlán, SV | 1 |
| DULlocation not on record | 1 |
| Madrid, ES | 1 |
| NO DISPONIBLElocation not on record | 1 |
| Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record | 1 |
| NSMKlocation not on record | 1 |
| Bangkok, TH | 1 |
| Hobart, AU | 1 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 1 |
| Madison, US | 1 |
| Ann Arbor, US | 1 |
| Millersville, US | 1 |
| San Angelo, US | 1 |
| Firenze, IT | 1 |
| Tlalnepantla, MX | 1 |
| Universidad de Caldas (UCaldas)location not on record | 1 |
| Pelotas, BR | 1 |
| Miami, US | 1 |
| Tilburg, NL | 1 |
| Akita Prefectural Museumlocation not on record | 1 |
| PrivatHerblocation not on record | 1 |
| Campo Grande, BR | 1 |
| nlocation not on record | 1 |
| Jaén, ES | 1 |
| Madrid, ES | 1 |
| Chicago, US | 1 |
| Jiujiang Forestry Institutelocation not on record | 1 |
| Yaoundé, CM | 1 |
| UFMSlocation not on record | 1 |
| Alicante, ES | 1 |
| Musée des Confluenceslocation not on record | 1 |
| Linares, MX | 1 |
| Universidad Nacional de Asunciónlocation not on record | 1 |
| HNBlocation not on record | 1 |
| Castelar, AR | 1 |
| Provo, US | 1 |
| Xian, CN | 1 |
| South China Normal Universitylocation not on record | 1 |
| Badajoz, ES | 1 |
| Instituto de Ecología, Universidad Nacional Autónoma de Méxicolocation not on record | 1 |
| FUNEDlocation not on record | 1 |
| Jiangxi College of Educationlocation not on record | 1 |
| Uniwersytet Warszawskilocation not on record | 1 |
| Xian, CN | 1 |
| JMSlocation not on record | 1 |
| Museo Nacional de Costa Rica (MNCR)location not on record | 1 |
| Montecillo, Texcoco, MX | 1 |
| Taipei, TW | 1 |
| Columbia, US | 1 |
| Viña del Mar, CL | 1 |
| NEAUlocation not on record | 1 |
| 黔东南州民族医药研究所标本室location not on record | 1 |
| Instituto Nacional de Biodiversidad Herbario, Costa Ricalocation not on record | 1 |
| Zhejiang Universitylocation not on record | 1 |
| University of Guelph, OAC Herbariumlocation not on record | 1 |
| Mexico City, MX | 1 |
| Jardín Botánico José Celestino Mutis (JBBJCM)location not on record | 1 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 1 |
| Santa Cruz de la Sierra, BO | 1 |
| Museo Achille Folettolocation not on record | 1 |
| MEXUlocation not on record | 1 |
| La Paz, BO | 1 |
| College Park, US | 1 |
| Urumqi, CN | 1 |
| Universidad Autónoma de Nayaritlocation not on record | 1 |
| Sociedad para el Estudio de los Recursos Bióticos de Oaxaca, A. C.location not on record | 1 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 1 |
| Institut fur Allgemeine Mikrobiologielocation not on record | 1 |
| AASlocation not on record | 1 |
| Jyväskylä, FI | 1 |
| UNICAMPlocation not on record | 1 |
| Turku, FI | 1 |
| Universidade Federal de Santa Catarinalocation not on record | 1 |
| Phyletisches Museum Jenalocation not on record | 1 |
| San Jose, US | 1 |
| KIWElocation not on record | 1 |
| Universidade Federal do Espírito Santolocation not on record | 1 |
| Criciúma, BR | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| Jataí / Setor Industrial, BR | 1 |
| Altos de Pipe, VE | 1 |
| Arizona State University Biocollectionslocation not on record | 1 |
| QCNElocation not on record | 1 |
| Palmerston, AU | 1 |
| JBRJlocation not on record | 1 |
| Osaka, JP | 1 |
| Moscow, US | 1 |
| UERJlocation not on record | 1 |
| Palmerston North, NZ | 1 |
| Smithfield, AU | 1 |
| Kew, GB | 1 |
| SVK001location not on record | 1 |
| Museo naturalistico del Frignano Ferruccio Minghellilocation not on record | 1 |
| POL003location not on record | 1 |
| Tula State Universitylocation not on record | 1 |
| Fukushima Universitylocation not on record | 1 |
| New Haven, US | 1 |
| Boise, US | 1 |
| GJOlocation not on record | 1 |
| UFSClocation not on record | 1 |
| UFVJMlocation not on record | 1 |
| Chaguaramas, TT | 1 |
| UNEMATlocation not on record | 1 |
| Mexico City, MX | 1 |
| Williamsburg, US | 1 |
| KMNlocation not on record | 1 |
| Irvine, US | 1 |
366 institutions · 2 644 of 2 842 vouchered records shown · 185 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA61 detections
Where the DNA of Coriandrum sativum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found61
Studies independent surveys3
Countries5
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 61 detections have coordinates
Open the map5 countries0
Palearctic
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median7.20 °C 7.20–15.4
Seasonal swing summer↔winter20.3 °C
Max temp (day)12.9 °C 12.9–20.0
Min temp (night)1.80 °C 1.80–10.4
Precipitation72.9 mm/mo
Air humidity58.2 % 58.2–59.7
Moisture balance45.8 mm/mo -1.90–45.8
Vapour deficit427 Pa 427–714
Wind speed0.9 m/s 0.9–2.90
Cloud cover43.3 % 41.2–43.3
CHELSA 1981–2010, ~9 km grid, at location & month of 52 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.