Coregonus hoyi

(Milner, 1874) · species

image placeholder — illustration coming later

Animalia/Chordata/Salmoniformes/Salmonidae/Coregonus

At a glance

Occurrence records15 910

Data sources11

Biological traits0

DNA specimens44

eDNA detections5

Sources11 archives

Databases and archives Coregonus hoyi's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

Animal Diversity WebUniv. of Michigan MZspecies account↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility15 910 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics44 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeADW · Wikipediaarticle

Occurrence & distributionGBIF15 910 records

Environmental DNA1 datasets · 0 countries5 detections

DNA & barcodingBOLD44 specimens

Genome at a glanceGoaT2.7 Gbp

01Narrative

Coregonus hoyi, also known as the bloater, is a species or form of freshwater whitefish in the family Salmonidae. It is a silvery-coloured herring-like fish, 25.5 cm long. It is found in most of the Great Lakes and in Lake Nipigon, and inhabits underwater slopes. This fish is not to be confused with the extinct deepwater cisco (Coregonus johannae), a large fish that shared a common name with the bloater.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding44 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Coregonus hoyi has left across the world's sequence archives.

At a glance

DNA specimens44

BINs1

Marker genes1

eDNA detections5

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus44 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.10%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 1 variable positions, in barcode order

337Tmostly conserved

CCTTTATTTAGTATTTGGTGCCTGAGCCGGAATAGTCGGCACAGCCCTAAGCCTTTTAATCCGAGCGGAACTAAGCCAACCTGGGGCTCT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Coregonus muksunsame genus1.9%Coregonus maraenasame genus2.1%Coregonus lavaretussame genus2.1%Coregonus albulasame genus2.2%Coregonus pidschiansame genus2.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_054288 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND1ND2COICOIIATP8ATP6COIIIND3ND4LND4ND5ND6CYTBrrn12rrn16

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT

The complete instruction manual Coregonus hoyi carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size2 709 060 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Coregonus hoyi2.71 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 80 n = 40

Chromosome records80–802n range80median80mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 802×GoaT · Animal Chromosome Counts Database · GoaT · Animal Genome Size Database

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Animal Genome Size Database — ↗

08Occurrence & distribution

Record type15 910 records

Wild obs. + sensor15 004

Museum / vouchered906

Origin

Native2

Range

Area of Occupancy AOO8 948 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy11% within 1 km

≤1 km 1>10 km 8

9 georeferenced · 14 995 without coordinates

Open the mapobservation + sensor15 004

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy95% within 1 km

≤100 m 135≤1 km 8≤10 km 2>10 km 5

150 georeferenced · 756 without coordinates

Open the institutions mapphysical evidence906

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Ann Arbor, US	525
Toronto, CA	320
Washington, US	14
Chicago, US	11
Central Michigan University Museum of Cultural and Natural Historylocation not on record	7
Champaign, US	7
University of Minnesota, James Ford Bell Museum of Natural Historylocation not on record	5
Cambridge, US	4
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	2
CASlocation not on record	2
University of Alabamalocation not on record	2
Ohio State University - Fish Division, Columbus, OH (OSUM)location not on record	2
North Carolina Museum of Natural Scienceslocation not on record	1
University of California San Diegolocation not on record	1

14 institutions · 903 of 906 vouchered records shown · 3 without an institution code

09Environmental DNA5 detections

Where the DNA of Coregonus hoyi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Coregonus hoyi

At a glance

Sources11 archives

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type15 910 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions6 of 14 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type15 910 records