Cordia monoica

Roxb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Boraginales/Cordiaceae/Cordia

At a glance

Occurrence records531

Data sources12

Biological traits28

DNA specimens21

eDNA detections12

Sources12 archives

Databases and archives Cordia monoica's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility531 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics21 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Tree of SexTree of Sex Consortiumgenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources28 traits

Occurrence & distributionGBIF531 records

Environmental DNA1 datasets · 3 countries12 detections

DNA & barcodingBOLD · NCBI21 specimens

Genome at a glanceCCDB · GoaT · TreeOfSex2n = 70

01Narrative

Cordia monoica là loài thực vật có hoa trong họ Mồ hôi. Loài này được Roxb. mô tả khoa học đầu tiên năm 1796.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology9

Plant height6.5 m

⚠ sources differ — GIFT: 6.5 m · TRY: 6 m

Plant height max5 m

Plant height min1 m

Seed mass97.33 mg

⚠ sources differ — TRY: 97.33 mg · GIFT: 125 mg

Seed mass max265 mg

Seed mass min80.28 mg

Seed volume180 mm³

Seed volume max180 mm³

Seed volume min180 mm³

Life cycle & reproduction5

Deciduousnessevergreen

Life formshrub or tree

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Elevation max830 m

Elevation min200 m

Epiphyteterrestrial

Fruit fleshinessfleshy

Growth formshrub

Habitat GIFTsemi-evergreen or deciduous bushland, or bushed grassland, often on rocks or along watercourses, less often in forest or woodland

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Wood density220 mg/cm³

Other traits1

Plant support typefree-standing

05DNA & barcoding21 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cordia monoica has left across the world's sequence archives.

At a glance

DNA specimens21

Marker genes7

GenBank sequences10

eDNA detections12

Countries3

The DNA barcodea real sequence read deposited for this species

ITSMK261116.1 ↗303 bpKenya · 2012

ACGT

TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAATCCTACAACACAAACGACCAGCGAACCTGTTGATCAACACGGGTGCGGGTGGC …

Cordia monoica voucher B8_K1213_Cordia_monoica small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, complete sequence; and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL6★rbcLa★trnL★trnL-F★ITS1trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB · GoaT · TreeOfSex

The complete instruction manual Cordia monoica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 70 n = 35

Ploidypolyploid inferred

Chromosome records70–702n range70median70mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 703×GoaT · Tree of Sex Database · CCDB · ipcn-api-dl · TreeOfSex · plant

GoaT · Tree of Sex Database — ↗

CCDB · ipcn-api-dl — Heubl, G. R., J. C. Gaviria & G. Wanner. 1990. A contribution to the taxonomy and evolution of Cordia (Boraginaceae) and allied genera. Bot. Jahrb. Syst. 112: 129–165.

TreeOfSex · plant — Goldblatt1979 ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type531 records

Wild obs. + sensor165

Museum / vouchered366

Range

Area of Occupancy AOO1 260 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 70≤1 km 10≤10 km 2>10 km 1

83 georeferenced · 82 without coordinates

Open the mapobservation + sensor165

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 3≤10 km 2>10 km 1

6 georeferenced · 360 without coordinates

Open the institutions mapphysical evidence366

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 44 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	72
Kew, GB	45
Saint Louis, US	42
Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record	11
Plocation not on record	10
Durban, ZA	9
MeiseBGlocation not on record	8
WAGlocation not on record	6
Berlin, DE	6
Pondicherry, IN	6
Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record	6
Wlocation not on record	5
Edinburgh, GB	5
Addis Ababa, ET	5
Haramaya Universitylocation not on record	5
University of Stellenboschlocation not on record	4
Uppsala, SE	4
Stockholm, SE	3
Clocation not on record	3
EAlocation not on record	3
TAFORI-LSRClocation not on record	3
Smithsonian Institution, National Museum of Natural History, United States National Herbariumlocation not on record	3
Glocation not on record	3
Gujarat Biodiversity Gene Banklocation not on record	2
MSB-3054location not on record	2
Instituto de Investigação Científica Tropicallocation not on record	2
Mlocation not on record	1
Honolulu, US	1
Centre National de la Recherche Appliquée au Developement Rurallocation not on record	1
University of Oxfordlocation not on record	1
University of Hamburglocation not on record	1
Montpellier, FR	1
South African National Biodiversity Institutelocation not on record	1
Dekalb, US	1
Xiamen, CN	1
BClocation not on record	1
Chongqing Museumlocation not on record	1
Paris, FR	1
National Institute of Biological Resourceslocation not on record	1
Frankfurt am Main	1
Institute for Agricultural Research of Mozambiquelocation not on record	1
University of Johannesburg, Department of Botany and Plant Biotechnologylocation not on record	1
University of Bayreuthlocation not on record	1
South Kensington, GB	1

44 institutions · 291 of 366 vouchered records shown · 75 without an institution code

09Environmental DNA12 detections

Where the DNA of Cordia monoica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map3 countries0

Red soil savanna bushland.

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.6 °C 18.5–27.8

Seasonal swing summer↔winter8.60 °C

Max temp (day)29.8 °C 23.4–32.1

Min temp (night)18.7 °C 13.1–24.5

Precipitation61.6 mm/mo 48.4–114

Air humidity56.9 % 53.9–61.2

Moisture balance-73.5 mm/mo -104–-49.5

Vapour deficit1,270 Pa 913–1,607

Wind speed2.50 m/s 2.30–3.70

Cloud cover36.5 % 6.80–47.2

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)