Corbicula leana

Prime, 1864 · species

image placeholder — illustration coming later

Animalia/Mollusca/Bivalvia/Venerida/Cyrenidae/Corbicula

At a glance

Occurrence records243

Data sources8

Biological traits2

DNA specimens109

eDNA detections1

Sources8 archives

Databases and archives Corbicula leana's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility243 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics109 specimens↗

LOTUSNatural Products (Wikidata)compounds↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF243 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD109 specimens

01Narrative

Corbicula leana, known as chamjaecheop (; "true jaecheop") in Korean and as mashijimi (; "true shijimi") in Japanese, is a species of freshwater and brackish water clams, distributed in the Korean Peninsula and the Japanese archipelago.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat freshwateryes

Habitat zonebenthic

03Chemical composition1 compounds

Compounds documented for Corbicula leana across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Cholestane steroids $ Stigmastane steroids1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
Poriferasterol		present	LOTUS

05DNA & barcoding109 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Corbicula leana has left across the world's sequence archives.

At a glance

DNA specimens109

BINs2

Marker genes1

eDNA detections1

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P660 bp consensus108 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 22 variable positions, in barcode order

8Amostly conserved

11Cmostly conserved

41Amostly conserved

60Amostly conserved

96Cmostly conserved

111Tmostly conserved

164Amostly conserved

170Amostly conserved

176Gmostly conserved

242Amostly conserved

290Amostly conserved

299Gmostly conserved

302Tvariable

350Tmostly conserved

398Tmostly conserved

476Amostly conserved

479Gmostly conserved

485Gmostly conserved

491Tmostly conserved

557Gmostly conserved

581Gmostly conserved

626Tmostly conserved

GGACTCTATACTTTCTTTTTTCTATTTGATCTGGTTTAATAGGAACTGCTTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.90%

Haplotypes6

BINs2

Most divergent pair3.2%

AsiaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Corbicula elatiorsame genus1.7%Corbicula sandaisame genus1.7%Corbicula fluminalissame genus1.8%Corbicula lamarckianasame genus1.8%Corbicula africanasame genus1.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type243 records

Wild obs. + sensor103

Museum / vouchered140

Range

Area of Occupancy AOO684 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy65% within 1 km

≤100 m 9≤1 km 2≤10 km 4>10 km 2

17 georeferenced · 86 without coordinates

Open the mapobservation + sensor103

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy57% within 1 km

≤1 km 4≤10 km 2>10 km 1

7 georeferenced · 133 without coordinates

Open the institutions mapphysical evidence140

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Gifu prefectural Museumlocation not on record	26
Philadelphia, US	23
Nishinomiya Shell Museumlocation not on record	10
Washington, US	7
Cambridge, US	5
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	5
Delaware Museum of Nature and Sciencelocation not on record	5
Gyeryonsan Natural History Museumlocation not on record	4
KSNHMlocation not on record	4
Sam Noble Oklahoma Museum of Natural Historylocation not on record	4
Wakayama Prefectural Museum of Natural Historylocation not on record	2
Florida Atlantic University, Harbor Branch Oceanographic Museumlocation not on record	2
North Carolina Museum of Natural Scienceslocation not on record	2
Santa Barbara Museum of Natural Historylocation not on record	1
Natural History Museum of Utahlocation not on record	1
Barcelona, ES	1
Alabama Museum of Natural Historylocation not on record	1
Tomioka, JP	1
Ann Arbor, US	1
Chicago, US	1

20 institutions · 106 of 140 vouchered records shown · 34 without an institution code

09Environmental DNA1 detections

Where the DNA of Corbicula leana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)