Coprinopsis stercorea

(Fr.) Redhead, Vilgalys & Moncalvo · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Psathyrellaceae/Coprinopsis

At a glance

Occurrence records1 219

Data sources9

Biological traits0

DNA specimens5

eDNA detections151

Sources9 archives

Databases and archives Coprinopsis stercorea's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 219 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI151 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 219 records

Environmental DNA6 datasets · 14 countries151 detections

DNA & barcodingBOLD · NCBI5 specimens

01Narrative

Coprinopsis stercorea is a species of coprophilous fungus in the family Psathyrellaceae. It grows on the dung of sheep, goats and donkeys.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Coprinopsis stercorea has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes1

GenBank sequences9

eDNA detections151

Countries14

The DNA barcodea real sequence read deposited for this species

ITSMZ413178.1 ↗379 bp

ACGT

TCGTCAATGGGCTCTAAGCCTATAAAACGAAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATG …

Coprinopsis stercorea isolate 9P1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS9

fungal barcode

08Occurrence & distribution

Record type1 219 records

Wild obs. + sensor875

Museum / vouchered338

Other6

Origin

Native1

Range

Area of Occupancy AOO2 956 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤100 m 230≤1 km 184≤10 km 401>10 km 6

821 georeferenced · 54 without coordinates

Open the mapobservation + sensor875

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy76% within 1 km

≤100 m 23≤1 km 30≤10 km 16>10 km 1

70 georeferenced · 268 without coordinates

Open the institutions mapphysical evidence338

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions18 of 32 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Copenhagen, DK	12
WU-MYClocation not on record	10
DPIlocation not on record	9
SLU Artdatabankenlocation not on record	9
Göteborg, SE	8
Karlsruhe, DE	5
Olocation not on record	4
Trondheim, NO	4
Helsinki, FI	4
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	4
Kew, GB	2
San Sebastián, ES	2
Denver, US	2
Auckland, NZ	2
Uppsala, SE	2
IB FRC Komi SC UB RASlocation not on record	2
Zürich, CH	2
CJBGlocation not on record	2
UFPElocation not on record	2
Kensington, AU	1
Chicago, US	1
Senckenberg Gesellschaft für Naturforschung: Senckenberg Forschungsinstitut und Naturmuseumlocation not on record	1
Brisbane, AU	1
BDBClocation not on record	1
Museo Entomologico de Leonlocation not on record	1
Oulu, FI	1
Hobart, AU	1
Gijón, ES	1
University of Oslo, Natural History Museumlocation not on record	1
Kuopio, FI	1
Universidade de Lisboa, Museu Bocagelocation not on record	1
TROMlocation not on record	1

32 institutions · 100 of 338 vouchered records shown · 238 without an institution code

09Environmental DNA151 detections

Where the DNA of Coprinopsis stercorea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found151

Studies independent surveys6

Countries14

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 151 detections have coordinates

Open the map14 countries0

AfrotropicPalearcticLÃ¸vskog, leirjord

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

pH6.15 5.90–6.40

Conductivity110 µS/cm 69.0–150

Organic carbon3.73 % 3.59–3.86

Nitrate-N31.5 mg/kg 13.0–50.0

Phosphorus78.0 mg/kg 37.0–119

Depth0 m

SoilKandosol

2 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.9 °C 2.60–13.9

Seasonal swing summer↔winter24.5 °C

Max temp (day)13.2 °C 4.20–17.4

Min temp (night)7.10 °C -1.10–9.80

Precipitation95.1 mm/mo 74.1–219

Air humidity63.8 % 60.2–72.2

Moisture balance32.8 mm/mo -36.9–170

Vapour deficit472 Pa 207–691

Wind speed2.90 m/s 2.10–7.60

Cloud cover63.6 % 43.8–63.7

CHELSA 1981–2010, ~9 km grid, at location & month of 149 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Coprinopsis stercorea

At a glance

Sources9 archives

At a glance

Record type1 219 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions18 of 32 geolocated

Signal

Where its DNA was found

How strong is each trace?

Measured at samplingin-field

Modelled climatemodelled

Record type1 219 records