Coprinopsis radiata

(Bolton) Redhead, Vilgalys & Moncalvo · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Psathyrellaceae/Coprinopsis

At a glance

Occurrence records524

Data sources9

Biological traits0

DNA specimens6

eDNA detections80

Sources9 archives

Databases and archives Coprinopsis radiata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility524 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI80 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF524 records

Environmental DNA6 datasets · 4 countries80 detections

DNA & barcodingBOLD · NCBI6 specimens

01Narrative

Coprinopsis radiata (formerly Coprinus radiatus) is a coprophilous fungus that grows on herbivore dung. It is heterothallic.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Coprinopsis radiata has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes2

GenBank sequences9

eDNA detections80

Countries4

The DNA barcodea real sequence read deposited for this species

ITSMZ567595.1 ↗279 bp

ACGT

TTATTGAATAAATCTGGCGTGGTTGTAGCTGGCCCTCACGGGCATGTGCTCGCTCGTCACCTTTATCTTTCCACCTGTGAACACACTGTA …

Coprinopsis radiata clone New.CleanUp.ReferenceOTU6644 internal transcribed spacer 1 and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS9★ITS1

fungal barcode

08Occurrence & distribution

Record type524 records

Wild obs. + sensor398

Museum / vouchered122

Cultivated / captive1

Other3

Range

Area of Occupancy AOO1 512 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy24% within 1 km

≤100 m 51≤1 km 41≤10 km 286

378 georeferenced · 20 without coordinates

Open the mapobservation + sensor398

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy48% within 1 km

≤100 m 10≤1 km 11≤10 km 15>10 km 8

44 georeferenced · 78 without coordinates

Open the institutions mapphysical evidence122

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 28 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	13
WU-MYClocation not on record	8
Kyiv, UA	6
Karlsruhe, DE	5
BDBClocation not on record	4
Olocation not on record	3
Kew, GB	3
Philadelphia, US	3
SLU Artdatabankenlocation not on record	3
Zürich, CH	2
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	2
Toronto, CA	2
Davis and Elkins Collegelocation not on record	2
Copenhagen, DK	2
Gijón, ES	1
Stockholm, SE	1
Turku, FI	1
Kuopio, FI	1
San Sebastián, ES	1
Bardejov, SK	1
Chicago, US	1
National Mushroom Centre, Department of Agriculture, Ministry of Agriculture and Livestock, Bhutanlocation not on record	1
Auckland, NZ	1
Toyota city nature sanctuarylocation not on record	1
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	1
DPIlocation not on record	1
Catholic University of Pekinglocation not on record	1
Görlitz, DE	1

28 institutions · 72 of 122 vouchered records shown · 50 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA80 detections

Where the DNA of Coprinopsis radiata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found80

Studies independent surveys6

Countries4

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 80 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

Temperature17.0 °C 12.0–29.0

pH6.10 4.30–7.50

Conductivity108 µS/cm 40.0–217

Organic carbon3.83 % 1.01–5.04

Water content5.45 % 4.60–14.9

Nitrate-N15.0 mg/kg 2.00–59.0

Phosphorus46.0 mg/kg 6.00–214

Clay16.9 % 10.0–30.1

Sand71.2 % 37.8–85.9

Depth0 m 0–0.2

MarineSoilSodosolFerrosolPodosolTenosolVertosolCalcarosol

23 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.3 °C 11.0–17.4

Seasonal swing summer↔winter19.3 °C

Max temp (day)19.0 °C 14.5–21.4

Min temp (night)9.20 °C 6.50–13.3

Precipitation60.8 mm/mo 44.1–86.6

Air humidity58.4 % 55.8–63.7

Moisture balance-50.6 mm/mo -83.9–15.6

Vapour deficit683 Pa 482–835

Wind speed3.80 m/s 2.80–4.40

Cloud cover38.4 % 19.2–48.1

CHELSA 1981–2010, ~9 km grid, at location & month of 72 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)