Coprinopsis nivea

(Pers.) Redhead, Vilgalys & Moncalvo · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Psathyrellaceae/Coprinopsis

At a glance

Occurrence records3 293

Data sources9

Biological traits0

DNA specimens2

eDNA detections24

Sources9 archives

Databases and archives Coprinopsis nivea's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 293 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI24 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF3 293 records

Environmental DNA7 datasets · 6 countries24 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Coprinopsis nivea is a species of mushroom producing fungus in the family Psathyrellaceae. It is commonly known as the snowy inkcap.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Coprinopsis nivea has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes1

GenBank sequences9

eDNA detections24

Countries6

The DNA barcodea real sequence read deposited for this species

ITSPV715508.1 ↗483 bpChina · 2019

ACGT

TAAATCTGATGTGGTTGTAGCTGGCTCTCCGGAGCATGTGCACGCCCGTCACCTTTATCTCACTCCCTGTGCACACACTGTAGGCTCGGA …

Coprinopsis nivea voucher HKAS 124713 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS9

fungal barcode

08Occurrence & distribution

Record type3 293 records

Wild obs. + sensor3 049

Museum / vouchered219

Other25

Range

Area of Occupancy AOO9 220 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy60% within 1 km

≤100 m 1 059≤1 km 546≤10 km 1 047>10 km 43

2 695 georeferenced · 354 without coordinates

Open the mapobservation + sensor3 049

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy64% within 1 km

≤100 m 27≤1 km 43≤10 km 19>10 km 21

110 georeferenced · 109 without coordinates

Open the institutions mapphysical evidence219

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions19 of 31 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	27
Copenhagen, DK	26
SLU Artdatabankenlocation not on record	15
BDBClocation not on record	14
Kew, GB	13
San Sebastián, ES	10
Olocation not on record	9
Denver, US	8
Karlsruhe, DE	7
Göteborg, SE	7
TROMlocation not on record	6
Kyiv, UA	6
Philadelphia, US	5
WU-MYClocation not on record	5
Tartu, EE	3
Museo Entomologico de Leonlocation not on record	3
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	3
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	3
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	2
Vitoria, ES	2
Görlitz, DE	1
Chicago, US	1
Turku, FI	1
Gijón, ES	1
Auckland, NZ	1
nsnflocation not on record	1
Staten Island, US	1
JA-CAGPDS-CAMlocation not on record	1
Vancouver, CA	1
Trondheim, NO	1
MAlocation not on record	1

31 institutions · 185 of 219 vouchered records shown · 34 without an institution code

09Environmental DNA24 detections

Where the DNA of Coprinopsis nivea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found24

Studies independent surveys7

Countries6

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 24 detections have coordinates

Open the map6 countries0

Neotropic

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

pH5.95 4.00–8.30

Conductivity47.5 µS/cm 18.0–158

Organic carbon1.45 % 0.14–4.62

Water content9.38 % 0.508–21.8

Nitrate-N2.00 mg/kg 1.00–50.0

Phosphorus19.0 mg/kg 2.00–165

Clay9.56 % 2.89–32.3

Sand85.3 % 34.0–96.1

Depth0 m 0–0.2

SoilKurosolRudosolSodosolKandosolLatLon out of range

10 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.5 °C 13.0–24.2

Seasonal swing summer↔winter12.4 °C

Max temp (day)23.2 °C 14.7–30.2

Min temp (night)13.7 °C 8.20–22.6

Precipitation58.7 mm/mo 16.8–114

Air humidity57.9 % 52.7–62.6

Moisture balance-70.8 mm/mo -146–-1.70

Vapour deficit904 Pa 556–1,237

Wind speed2.40 m/s 1.90–4.40

Cloud cover25.4 % 14.7–42.1

CHELSA 1981–2010, ~9 km grid, at location & month of 21 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Coprinopsis nivea

At a glance

Sources9 archives

At a glance

Record type3 293 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions19 of 31 geolocated

Signal

Where its DNA was found

How strong is each trace?

Measured at samplingin-field

Modelled climatemodelled

Record type3 293 records