Coprinopsis acuminata

(Romagn.) Redhead, Vilgalys & Moncalvo · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Psathyrellaceae/Coprinopsis

At a glance

Occurrence records1 269

Data sources9

Biological traits0

DNA specimens3

eDNA detections52

Sources9 archives

Databases and archives Coprinopsis acuminata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 269 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI52 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 269 records

Environmental DNA7 datasets · 7 countries52 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Coprinopsis acuminata, commonly known as the humpback inkcap mushroom and earlier as Coprinus acuminatus, is a coprophilous fungus that grows on herbivore dung. It is heterothallic.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Coprinopsis acuminata has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes1

GenBank sequences7

eDNA detections52

Countries7

The DNA barcodea real sequence read deposited for this species

ITSPQ741111.1 ↗315 bpPoland · 2023

ACGT

GAACCTGCGGAAGGATCATTATCGAATAAATCTGACGTGGTTGTAGCTGGCTCTCCCGGGGCATGTGCACACCCGTCACCTTTATCTTTC …

Coprinopsis acuminata clone SH1566143.08FU small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, complete sequence; and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS7

fungal barcode

08Occurrence & distribution

Record type1 269 records

Wild obs. + sensor1 069

Museum / vouchered200

Range

Area of Occupancy AOO3 372 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy52% within 1 km

≤100 m 272≤1 km 250≤10 km 483>10 km 1

1 006 georeferenced · 63 without coordinates

Open the mapobservation + sensor1 069

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy94% within 1 km

≤100 m 27≤1 km 19≤10 km 1>10 km 2

49 georeferenced · 151 without coordinates

Open the institutions mapphysical evidence200

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions18 of 27 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kew, GB	19
Karlsruhe, DE	14
Copenhagen, DK	11
Kyiv, UA	8
Philadelphia, US	6
Helsinki, FI	5
Trondheim, NO	5
WU-MYClocation not on record	4
SLU Artdatabankenlocation not on record	4
Görlitz, DE	3
San Sebastián, ES	3
Kuopio, FI	3
Göteborg, SE	3
Olocation not on record	3
Denver, US	2
BDBClocation not on record	2
Oulu, FI	2
LDlocation not on record	2
NAlocation not on record	1
Bardejov, SK	1
TUR-Alocation not on record	1
Turku, FI	1
Tomioka, JP	1
GJOlocation not on record	1
Salzburg, AT	1
University of Oslo, Natural History Museumlocation not on record	1
Gijón, ES	1

27 institutions · 108 of 200 vouchered records shown · 92 without an institution code

09Environmental DNA52 detections

Where the DNA of Coprinopsis acuminata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found52

Studies independent surveys7

Countries7

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 52 detections have coordinates

Open the map7 countries0

Birch sphagnum forestAspen forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.2 °C 4.80–18.7

Seasonal swing summer↔winter22.9 °C

Max temp (day)17.6 °C 7.20–21.2

Min temp (night)9.60 °C 0.1–16.0

Precipitation84.3 mm/mo 58.4–96.5

Air humidity60.8 % 58.6–68.6

Moisture balance-16.2 mm/mo -66.7–62.5

Vapour deficit622 Pa 279–874

Wind speed3.90 m/s 2.40–5.50

Cloud cover41.8 % 36.6–60.3

CHELSA 1981–2010, ~9 km grid, at location & month of 50 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Coprinopsis acuminata

At a glance

Sources9 archives

At a glance

Record type1 269 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions18 of 27 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 269 records