Coprinellus xanthothrix

(Romagn.) Vilgalys, Hopple & Jacq.Johnson · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Psathyrellaceae/Coprinellus

At a glance

Occurrence records1 103

Data sources9

Biological traits0

DNA specimens31

eDNA detections1 172

Sources9 archives

Databases and archives Coprinellus xanthothrix's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 103 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 172 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics31 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS4 compounds

Occurrence & distributionGBIF1 103 records

Environmental DNA7 datasets · 22 countries1 172 detections

DNA & barcodingBOLD · NCBI31 specimens

01Narrative

Coprinellus xanthothrix is a species of fungus in the family Psathyrellaceae. This species was isolated from a polyphenol-polluted site near an olive processing plant in Greece. Shown to have the enzymes laccase and manganese peroxidase, the fungus is able to decolorize the recalcitrant polymeric dye R-478. First described as Coprinus xanthothrix by the French mycologist Henri Romagnesi in 1941, it was later transferred to the genus Coprinellus in 2001.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition4 compounds

Compounds documented for Coprinellus xanthothrix across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Drimane sesquiterpenoids1

Pyridine alkaloids1

Apocarotenoids(ε-)1

Documented compounds4 total

Tissue Source Quantified only

Compound	Amount	Source
(2S,3S,4S,4aS,8aS)-4-(hydroxymethyl)-3,4a,8,8-tetramethyl-2,4,5,6,7,8a-hexahydro-1H-naphthalene-2,3-diol	present	LOTUS
(4E)-5-[(1S)-1-hydroxy-2,6,6-trimethyl-4-oxocyclohex-2-en-1-yl]-3-methylpenta-2,4-dienoic acid	present	LOTUS
1-(2-Hydroxyethyl)pyrrole	present	LOTUS
1-[(2R,4R)-1-[(2E,4S,5R,6Z)-6-amino-5-methylnona-2,6-dien-4-yl]-4-methylpiperidin-2-yl]oxyheptan-2-one	present	LOTUS

05DNA & barcoding31 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Coprinellus xanthothrix has left across the world's sequence archives.

At a glance

DNA specimens31

Marker genes2

GenBank sequences10

eDNA detections1 172

Countries22

The DNA barcodea real sequence read deposited for this species

ITSOR770559.1 ↗601 bpGreece · 2022

ACGT

CGGAAGGATCATTAACGAATAACTATGGTGTCTTGGTTGTAGCTGGCTCTTCGGAGCAATGTGCACGCCCGCCATTTTTATCTTTCCACC …

Coprinellus xanthothrix voucher WC_191022_28 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1

fungal barcode

08Occurrence & distribution

Record type1 103 records

Wild obs. + sensor702

Museum / vouchered400

Other1

Origin

Native1

Range

Area of Occupancy AOO2 920 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy30% within 1 km

≤100 m 120≤1 km 43≤10 km 376>10 km 3

542 georeferenced · 160 without coordinates

Open the mapobservation + sensor702

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy72% within 1 km

≤100 m 38≤1 km 53≤10 km 19>10 km 17

127 georeferenced · 273 without coordinates

Open the institutions mapphysical evidence400

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions18 of 37 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	54
Karlsruhe, DE	29
Copenhagen, DK	13
Görlitz, DE	10
Olocation not on record	7
Zürich, CH	6
SLU Artdatabankenlocation not on record	5
Salzburg, AT	4
nsnflocation not on record	4
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	4
San Sebastián, ES	4
WU-MYClocation not on record	3
Kew, GB	3
Gujarat Biodiversity Gene Banklocation not on record	3
Oulu, FI	2
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	2
Kuopio, FI	2
Auckland, NZ	2
Staten Island, US	2
California State University, East Baylocation not on record	2
Uniwersytet Łódzkilocation not on record	2
Warsaw, PL	2
University of Oslo, Natural History Museumlocation not on record	2
Senckenberg Gesellschaft für Naturforschung: Senckenberg Forschungsinstitut und Naturmuseumlocation not on record	1
National Institute of Biological Resourceslocation not on record	1
Tartu, EE	1
Museo Achille Folettolocation not on record	1
Provincia di Livornolocation not on record	1
UNICAMPlocation not on record	1
University of Uppsalalocation not on record	1
JA-CAGPDS-CAMlocation not on record	1
NAlocation not on record	1
Vancouver, CA	1
Trondheim, NO	1
Uppsala, SE	1
Department of Plant Resources, National Herbarium and Plant Laboratorieslocation not on record	1
Bardejov, SK	1

37 institutions · 181 of 400 vouchered records shown · 218 without an institution code

09Environmental DNA1 172 detections

Where the DNA of Coprinellus xanthothrix was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1 172

Studies independent surveys7

Countries22

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 172 detections have coordinates

Open the map22 countries0

ShrublandEdellÃ¸vli

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

pH5.30 4.70–8.10

Conductivity13.0 µS/cm 11.0–359

Organic carbon0.52 % 0.38–1.00

Nitrate-N3.00 mg/kg

Phosphorus5.00 mg/kg

Clay3.89 % 2.93–15.9

Sand93.1 % 78.2–95.1

Depth0 m 0–0.2

SoilPodosolCalcarosolKurosol

4 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.1 °C 7.20–19.6

Seasonal swing summer↔winter20.5 °C

Max temp (day)18.4 °C 9.80–24.8

Min temp (night)10.2 °C 4.10–15.4

Precipitation63.6 mm/mo 35.0–93.5

Air humidity60.4 % 54.1–64.8

Moisture balance-24.0 mm/mo -87.9–32.9

Vapour deficit685 Pa 363–959

Wind speed3.40 m/s 2.40–5.10

Cloud cover38.2 % 23.0–55.8

CHELSA 1981–2010, ~9 km grid, at location & month of 1 127 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Coprinellus xanthothrix

At a glance

Sources9 archives

Compound class profile3 classes

Documented compounds4 total

At a glance

Record type1 103 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions18 of 37 geolocated

Signal

Where its DNA was found

How strong is each trace?

Measured at samplingin-field

Modelled climatemodelled

Record type1 103 records