Coprinellus truncorum

(Scop.) Redhead, Vilgalys & Moncalvo · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Psathyrellaceae/Coprinellus

At a glance

Occurrence records989

Data sources9

Biological traits0

DNA specimens4

eDNA detections5

Sources9 archives

Databases and archives Coprinellus truncorum's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility989 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF989 records

Environmental DNA2 datasets · 2 countries5 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Coprinellus truncorum is a species of mushroom-forming fungus in the family Psathyrellaceae. Part of the cluster of mushrooms morphologically related to Coprinellus micaceus, this species can be distinguished from C. micaceus by a smooth, rather than pruinose (powdery) stipe, and by having more elliptical spores. Although not conclusively proven, this species may be conspecific with C. micaceus.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Coprinellus truncorum has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes1

GenBank sequences4

eDNA detections5

Countries2

The DNA barcodea real sequence read deposited for this species

ITSFM878006.1 ↗567 bp

ACGT

TGGTTGTAGCTGGCTCCTCGGAGCATTGTGCACGCCCGCCATTTTTATCTATCCACCTGTGCACCGATTGTAGGTCTGGATGACTCTCGN …

Coprinellus truncorum ITS1, 5.8S rRNA gene and partial ITS2, strain SZMC-NL-1101

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS4

fungal barcode

08Occurrence & distribution

Record type989 records

Wild obs. + sensor855

Museum / vouchered129

Other5

Origin

Native5

Range

Area of Occupancy AOO2 268 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy11% within 1 km

≤100 m 27≤1 km 47≤10 km 592>10 km 7

673 georeferenced · 182 without coordinates

Open the mapobservation + sensor855

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy64% within 1 km

≤100 m 35≤1 km 6≤10 km 23

64 georeferenced · 65 without coordinates

Open the institutions mapphysical evidence129

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DPIlocation not on record	15
Karlsruhe, DE	12
Brisbane, AU	11
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	11
Kensington, AU	10
Toronto, CA	10
Kew, GB	9
Görlitz, DE	8
Uniwersytet Łódzkilocation not on record	6
Université de Montréal Biodiversity Centrelocation not on record	4
Adelaide, AU	3
WU-MYClocation not on record	3
Denver, US	2
Canberra, AU	2
Royal Ontario Museum, TRTC Fungariumlocation not on record	1
Mlocation not on record	1
BDBClocation not on record	1
Ann Arbor, US	1
Museo Entomologico de Leonlocation not on record	1
Kyiv, UA	1
Helsinki, FI	1

21 institutions · 113 of 129 vouchered records shown · 16 without an institution code

09Environmental DNA5 detections

Where the DNA of Coprinellus truncorum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys2

Countries2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map2 countries0

In soil by dead wood in garden

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median0.8 °C -2.20–3.80

Seasonal swing summer↔winter21.8 °C

Max temp (day)4.50 °C 0.9–8.10

Min temp (night)-2.90 °C -5.00–-0.8

Precipitation67.8 mm/mo 67.4–68.2

Air humidity60.4 % 60.2–60.6

Moisture balance25.0 mm/mo 19.6–30.4

Vapour deficit269 Pa 212–326

Wind speed5.30 m/s 3.30–7.30

Cloud cover51.6 % 48.4–54.8

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)