Coprinellus radians

(Desm.) Vilgalys, Hopple & Jacq.Johnson · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Psathyrellaceae/Coprinellus

At a glance

Occurrence records838

Data sources10

Biological traits0

DNA specimens38

eDNA detections66

Sources10 archives

Databases and archives Coprinellus radians's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility838 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI66 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics38 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS · NPASS24 compounds

Occurrence & distributionGBIF838 records

Environmental DNA4 datasets · 20 countries66 detections

DNA & barcodingBOLD · NCBI38 specimens

01Narrative

Coprinellus radians is a species of mushroom in the family Psathyrellaceae. First described as Agaricus radians by the mycologist John Baptiste Henri Joseph Desmazières in 1828, it was later transferred to the genus Coprinellus in 2001.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition24 compounds

Compounds documented for Coprinellus radians across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Guanacastane diterpenoids13

Flavones7

Benzoquinones1

Flavanones1

Stigmastane steroids1

Documented compounds24 total

Tissue Source Quantified only

Compound	Amount	Source
(2s)-5,7,3',4'-Tetramethoxyflavanone	present	NPASS
2-(1,3-Benzodioxol-5-yl)-5-hydroxy-6,8-dimethoxy-4H-1-benzopyran-4-one	present	NPASS
2-Methoxy-5-methyl-1,4-benzoquinone	present	LOTUS
5,6-Dihydroxy-4',7,8-trimethoxyflavone	present	NPASS
5,7,2',5'-Tetramethoxyflavone	present	NPASS
5-Hydroxy-3-(2-hydroxypropan-2-yl)-2-(5-methoxy-2,3-dihydro-1,4-benzodioxin-7-yl)-6,7-dimethyl-4-oxochromene-8-carboxylic acid	present	NPASS
5-Hydroxy-7,2'-dimethoxyflavone	present	NPASS
5-Hydroxy-7,8-dimethoxyflavone	present	NPASS
beta-Sitosterol	present	NPASS
CXSAFETUPWYQEW-UHFFFAOYSA-N	present	NPASS

05DNA & barcoding38 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Coprinellus radians has left across the world's sequence archives.

At a glance

DNA specimens38

Marker genes2

GenBank sequences10

eDNA detections66

Countries20

The DNA barcodea real sequence read deposited for this species

ITSPZ259424.1 ↗206 bpUSA · 2021

ACGT

ACCTGCGGAAGGATCATTAACGAATAACTATGGTGTCTTGGTTGTAGCTGGCTCCTCGGAGCAATGTGCACGCCCGCCATTTTTATCTTT …

Coprinellus radians isolate JK167 voucher TENN:076677 small subunit ribosomal RNA gene and internal transcribed spacer 1, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1

fungal barcode

08Occurrence & distribution

Record type838 records

Wild obs. + sensor613

Museum / vouchered216

Cultivated / captive1

Other8

Origin

Native1

Range

Area of Occupancy AOO2 488 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy42% within 1 km

≤100 m 139≤1 km 53≤10 km 241>10 km 24

457 georeferenced · 156 without coordinates

Open the mapobservation + sensor613

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy59% within 1 km

≤100 m 15≤1 km 22≤10 km 9>10 km 17

63 georeferenced · 153 without coordinates

Open the institutions mapphysical evidence216

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions19 of 38 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Karlsruhe, DE	24
Helsinki, FI	21
Uniwersytet Łódzkilocation not on record	17
Copenhagen, DK	12
Kew, GB	9
Universidade Federale do Rio Grande do Sullocation not on record	8
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	7
WU-MYClocation not on record	7
Görlitz, DE	4
Chicago, US	4
Olocation not on record	3
BDBClocation not on record	2
SLU Artdatabankenlocation not on record	2
St. Paul, US	2
Bando, JP	2
Kensington, AU	2
Kyiv, UA	2
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	2
Auckland, NZ	2
Toronto, CA	2
Osaka, JP	1
Private Collection of Jessica Rosslocation not on record	1
Université de Montréal Biodiversity Centrelocation not on record	1
JBRJlocation not on record	1
Personal Herbarium of Joanne Schwartzlocation not on record	1
Trondheim, NO	1
TNMlocation not on record	1
Gujarat Biodiversity Gene Banklocation not on record	1
Research Collection of Joanne Schwartzlocation not on record	1
California State University, East Baylocation not on record	1
Oulu, FI	1
Ann Arbor, US	1
National Institute of Biological Resourceslocation not on record	1
Kuopio, FI	1
San Sebastián, ES	1
University of Oslo, Natural History Museumlocation not on record	1
nsnflocation not on record	1
Trondheim, NO	1

38 institutions · 152 of 216 vouchered records shown · 61 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA66 detections

Where the DNA of Coprinellus radians was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found66

Studies independent surveys4

Countries20

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 66 detections have coordinates

Open the map20 countries0

Oak woodland, below roadside leaf litterVierkratt i beitemark. Pa vierstamme.In Leaf litter; Oak woodland, side of dirt r…PalearcticNeotropicAfrotropic

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.1 °C 8.20–27.0

Seasonal swing summer↔winter7.10 °C

Max temp (day)21.8 °C 12.2–29.0

Min temp (night)12.9 °C 3.90–25.1

Precipitation123 mm/mo 70.6–271

Air humidity63.4 % 56.0–68.7

Moisture balance35.7 mm/mo

Vapour deficit733 Pa 452–1,234

Wind speed2.50 m/s

Cloud cover34.5 % 22.0–55.3

CHELSA 1981–2010, ~9 km grid, at location & month of 37 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)