Coprinellus flocculosus

(DC.) Vilgalys, Hopple & Jacq.Johnson · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Psathyrellaceae/Coprinellus

At a glance

Occurrence records1 306

Data sources9

Biological traits0

DNA specimens10

eDNA detections231

Sources9 archives

Databases and archives Coprinellus flocculosus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 306 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI231 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionNPASS45 compounds

Occurrence & distributionGBIF1 306 records

Environmental DNA7 datasets · 8 countries231 detections

DNA & barcodingBOLD · NCBI10 specimens

01Narrative

Coprinellus flocculosus is a species of agaric fungus in the family Psathyrellaceae. It was first described as Agaricus flocculosus by mycologist Augustin Pyramus de Candolle in 1815, and later transferred to the genus Coprinellus in 2001.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition45 compounds

Compounds documented for Coprinellus flocculosus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Flavonols11

N-acyl amines8

Quinoline alkaloids4

Menthane monoterpenoids $ Monocyclic monoterpenoids3

Acyclic monoterpenoids2

Documented compounds45 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Linalyl acetate	present	NPASS
(1S,3R,4R,5R)-3-(3-(3,4-Dihydroxyphenyl)Prop-2-Enoyloxy)-1,4,5-Trihydroxycyclohexane-1-Carboxylic Acid	present	NPASS
(2e,6e,8e)-N-(2-hydroxy-2-methylpropyl)-10-oxo-2,6,8-decatrienamide	present	NPASS
(2E,6R,7E,9E)-6-hydroxy-N-(2-hydroxy-2-methylpropyl)-11-oxododeca-2,7,9-trienamide	present	NPASS
(2E,6Z,8E,10Z)-N-(2-hydroxy-2-methylpropyl)dodeca-2,6,8,10-tetraenamide	present	NPASS
(2e,7e,9e)-N-(2-hydroxy-2-methylpropyl)-6,11-dioxo-2,7,9-dodecatrienamide	present	NPASS
(2S)-2,6-dimethyl-2-(4-methylpent-3-enyl)pyrano[3,2-c]quinolin-5-one	present	NPASS
(R)-alpha-Terpineol	present	NPASS
1-((7aR)-5,6,7a,8-Tetrahydro-7H-benzo(g)-1,3-benzodioxolo(6,5,4-de)quinolin-7-yl)ethanone	present	NPASS
1-Methoxy-4-(2-propenyl)benzene	present	NPASS

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Coprinellus flocculosus has left across the world's sequence archives.

At a glance

DNA specimens10

Marker genes2

GenBank sequences10

eDNA detections231

Countries8

The DNA barcodea real sequence read deposited for this species

ITSOQ132777.1 ↗299 bpUSA · 2020

ACGT

AGCGCGGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGG …

Coprinellus flocculosus voucher iNaturalist.org/observations/61159175 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1

fungal barcode

08Occurrence & distribution

Record type1 306 records

Wild obs. + sensor1 155

Museum / vouchered151

Range

Area of Occupancy AOO3 868 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy73% within 1 km

≤100 m 652≤1 km 89≤10 km 190>10 km 80

1 011 georeferenced · 144 without coordinates

Open the mapobservation + sensor1 155

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy71% within 1 km

≤100 m 19≤1 km 27≤10 km 9>10 km 10

65 georeferenced · 86 without coordinates

Open the institutions mapphysical evidence151

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 27 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	26
Copenhagen, DK	15
Olocation not on record	8
WU-MYClocation not on record	7
Kew, GB	5
Karlsruhe, DE	5
San Sebastián, ES	4
SLU Artdatabankenlocation not on record	3
Kensington, AU	3
Toronto, CA	2
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	2
Göteborg, SE	2
Trondheim, NO	2
Philadelphia, US	2
Personal Herbarium of Joanne Schwartzlocation not on record	2
Université de Montréal Biodiversity Centrelocation not on record	2
Oulu, FI	1
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	1
Bronx, US	1
Ann Arbor, US	1
Hobart, AU	1
Denver, US	1
Gijón, ES	1
University of Oslo, Natural History Museumlocation not on record	1
CJBGlocation not on record	1
LDlocation not on record	1
National Mushroom Centre, Department of Agriculture, Ministry of Agriculture and Livestock, Bhutanlocation not on record	1

27 institutions · 101 of 151 vouchered records shown · 49 without an institution code

09Environmental DNA231 detections

Where the DNA of Coprinellus flocculosus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found231

Studies independent surveys7

Countries8

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 231 detections have coordinates

Open the map8 countries0

Park. Kvisthaug, organisk rÃ¥tnende tingLeaf litter and needle duff over mulch. Coni…Ondry chipped bark in irrigated residential …

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

Temperature17.0 °C 10.0–28.0

pH7.57 4.50–9.00

Conductivity234 µS/cm 36.0–14,020

Organic carbon1.10 % 0.07–4.97

Water content13.0 % 3.91–17.5

Nitrate-N9.90 mg/kg 1.00–520

Phosphorus39.0 mg/kg 5.00–165

Clay40.5 % 1.15–61.3

Sand39.2 % 9.90–95.2

Depth0 m 0–0.2

SoilMarineVertosolVertosolsTenosolKurosolCalcarosolHydrosols

61 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.2 °C 11.8–23.2

Seasonal swing summer↔winter15.1 °C

Max temp (day)20.1 °C 16.1–28.5

Min temp (night)10.0 °C 7.70–17.9

Precipitation47.9 mm/mo 29.5–88.1

Air humidity57.4 % 49.2–63.2

Moisture balance-56.4 mm/mo -122–1.70

Vapour deficit744 Pa 525–1,353

Wind speed3.60 m/s 2.50–4.20

Cloud cover25.3 % 14.7–41.1

CHELSA 1981–2010, ~9 km grid, at location & month of 225 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Coprinellus flocculosus

At a glance

Sources9 archives

Compound class profile5 classes

Documented compounds45 total

At a glance

Record type1 306 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions16 of 27 geolocated

Signal

Where its DNA was found

How strong is each trace?

Measured at samplingin-field

Modelled climatemodelled

Record type1 306 records