Coprinellus ellisii — The Life Data

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Psathyrellaceae/Coprinellus

At a glance

Occurrence records191

Data sources6

Biological traits0

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Coprinellus ellisii's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility191 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF191 records

DNA & barcodingNCBIsequences

01Narrative

Coprinellus ellisii is a species of mushroom in the family Psathyrellaceae. Found in Europe, it was first described as Coprinus ellisii by Peter D. Orton in 1960, and later transferred to the genus Coprinellus in 2001. The specific epithet ellisii honours E.A. Ellis, who, according to Orton, was "the Norfolk naturalist and mycologist who collected this and who brought me many puzzling and apparently undescribed agarics."

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Coprinellus ellisii has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences6

Countries3

The DNA barcodea real sequence read deposited for this species

ITSPP734659.1 ↗511 bp

ACGT

CTTTTGCCCTTTAGGGGGGGGAAGGGAGGGTTGCCCGTTCCCCCGGCTCCCCTCGAATTTCCAGGCTCTACGTCTTTTTACACACCCCAA …

Coprinellus ellisii voucher EF290 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS6

fungal barcode

08Occurrence & distribution

Record type191 records

Wild obs. + sensor141

Museum / vouchered47

Other3

Origin

Native2

Range

Area of Occupancy AOO564 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy17% within 1 km

≤100 m 12≤1 km 8≤10 km 97

117 georeferenced · 24 without coordinates

Open the mapobservation + sensor141

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy64% within 1 km

≤100 m 2≤1 km 16≤10 km 10

28 georeferenced · 19 without coordinates

Open the institutions mapphysical evidence47

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
WU-MYClocation not on record	12
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	6
BDBClocation not on record	5
Salzburg, AT	5
Karlsruhe, DE	4
Kew, GB	3
Görlitz, DE	2
Zürich, CH	1
CJBGlocation not on record	1
Mlocation not on record	1

10 institutions · 40 of 47 vouchered records shown · 7 without an institution code