Coprinellus curtus

(Kalchbr.) Vilgalys, Hopple & Jacq.Johnson · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Psathyrellaceae/Coprinellus

At a glance

Occurrence records77

Data sources8

Biological traits0

DNA specimens5

eDNA detections724

Sources8 archives

Databases and archives Coprinellus curtus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility77 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI724 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF77 records

Environmental DNA5 datasets · 10 countries724 detections

DNA & barcodingBOLD · NCBI5 specimens

01Narrative

Coprinellus curtus is a species of mushroom in the family Psathyrellaceae. It was first described as Coprinus curtus by Károly Kalchbrenner in 1876 before being transferred to the genus Coprinellus in 2001. A strain of this fungus (named GM-21) produces an anti-fungal compound known to inhibit bottom-rot disease of Chinese cabbage (Brassica campestris) caused by the plant pathogen Rhizonoctonia solani. It is a coprophilous fungus and it is known to grow on the dung of donkeys, sheep and goats.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Coprinellus curtus has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes1

GenBank sequences7

eDNA detections724

Countries10

The DNA barcodea real sequence read deposited for this species

ITSOW847513.1 ↗347 bp

ACGT

GAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATG …

Coprinellus curtus genomic DNA sequence contains ITS1

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS7

fungal barcode

08Occurrence & distribution

Record type77 records

Wild obs. + sensor36

Museum / vouchered40

Other1

Range

Area of Occupancy AOO248 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy38% within 1 km

≤100 m 6≤1 km 4≤10 km 16

26 georeferenced · 10 without coordinates

Open the mapobservation + sensor36

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy79% within 1 km

≤100 m 8≤1 km 7≤10 km 2>10 km 2

19 georeferenced · 21 without coordinates

Open the institutions mapphysical evidence40

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kyiv, UA	6
Kensington, AU	5
Copenhagen, DK	5
Karlsruhe, DE	3
WU-MYClocation not on record	3
Helsinki, FI	3
BDBClocation not on record	2
Olocation not on record	2
Toronto, CA	2
Kew, GB	1
Museo Entomologico de Leonlocation not on record	1

11 institutions · 33 of 40 vouchered records shown · 7 without an institution code

09Environmental DNA724 detections

Where the DNA of Coprinellus curtus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found724

Studies independent surveys5

Countries10

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 724 detections have coordinates

Open the map10 countries0

Afrotropic

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

Temperature21.0 °C 11.0–29.0

pH6.70 4.20–9.50

Conductivity138 µS/cm 11.0–130,600

Organic carbon1.17 % 0.003–15.0

Water content10.8 % 1.08–48.7

Nitrate-N4.29 mg/kg 0.006–150

Phosphorus21.0 mg/kg 2.00–290

Clay16.9 % 0.809–71.7

Sand66.9 % 2.00–96.1

Depth0 m 0–0.2

MarineSoilFerrosolKandosolRudosolSodosolTenosolsDermosol

253 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.2 °C 11.6–29.9

Seasonal swing summer↔winter13.7 °C

Max temp (day)25.8 °C 17.2–35.8

Min temp (night)14.8 °C 6.70–24.7

Precipitation28.4 mm/mo 1.90–91.6

Air humidity51.8 % 44.8–60.8

Moisture balance-103 mm/mo -179–-19.2

Vapour deficit1,148 Pa 584–2,272

Wind speed3.40 m/s 2.60–4.80

Cloud cover20.4 % 7.30–28.2

CHELSA 1981–2010, ~9 km grid, at location & month of 719 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)