Coprinellus bipellis

(Romagn.) P.Roux, Guy García & Borgarino · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Psathyrellaceae/Coprinellus

At a glance

Occurrence records223

Data sources8

Biological traits0

DNA specimens1

eDNA detections2

Sources8 archives

Databases and archives Coprinellus bipellis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility223 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF223 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Coprinellus bipellis is a species of mushroom in the family Psathyrellaceae. It was first described as Coprinus bipellis by Henri Romagnesi in 1976, and later transferred to the genus Coprinellus in 2006.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Coprinellus bipellis has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences3

eDNA detections2

Countries2

The DNA barcodea real sequence read deposited for this species

ITSON406157.1 ↗628 bp

ACGT

CGGAAGGATCATTAACGAATAACTATGGTGTCTTGGTTGTAGCTGGCTCCTCGGAGCAATGTGCACGCCCACCATTTTTATCTTTCCACC …

Coprinellus bipellis isolate DD26 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS3

fungal barcode

08Occurrence & distribution

Record type223 records

Wild obs. + sensor217

Museum / vouchered6

Range

Area of Occupancy AOO624 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 117≤1 km 17≤10 km 21>10 km 17

172 georeferenced · 45 without coordinates

Open the mapobservation + sensor217

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 1

2 georeferenced · 4 without coordinates

Open the institutions mapphysical evidence6

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
California State University, East Baylocation not on record	2
Gijón, ES	1
TENN-Flocation not on record	1
Helsinki, FI	1

4 institutions · 5 of 6 vouchered records shown · 1 without an institution code

09Environmental DNA2 detections

Where the DNA of Coprinellus bipellis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median8.60 °C 8.30–8.80

Seasonal swing summer↔winter14.5 °C

Max temp (day)13.2 °C 12.8–13.5

Min temp (night)4.20 °C 3.90–4.70

Precipitation240 mm/mo 165–314

Air humidity59.5 % 56.4–62.6

Moisture balance189 mm/mo 109–268

Vapour deficit452 Pa 409–494

Wind speed3.50 m/s 2.90–4.20

Cloud cover53.7 % 53.3–54.1

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)