Conophytum bilobum

(Marloth) N.E.Br. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Aizoaceae/Conophytum

At a glance

Occurrence records142

Data sources11

Biological traits14

DNA specimens4

eDNA detections3

Sources11 archives

Databases and archives Conophytum bilobum's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility142 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources14 traits

Occurrence & distributionGBIF142 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Conophytum bilobum is a plant in the family Aizoaceae, native to southern South Africa. It blooms in autumn. It is scentless and grows to a height of 7 cm. The specific epithet bilobum comes from the two-lobed bodies these plants possess.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height max0.8 m

Seed mass9.38 mg

Life cycle & reproduction2

Life formsucculent subshrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Elevation max1 200 m

Elevation min50 m

Epiphyteterrestrial

Growth formherb

⚠ sources differ — GIFT: herb · TRY: succulent

Woodinessnon-woody

Physiology & chemistry1

Specific leaf area (SLA)1.9 mm²/mg

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Conophytum bilobum has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes3

GenBank sequences2

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN317877.1 ↗683 bp

ACGT

AACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAAACTGCCATGCAGAA …

Conophytum bilobum small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcLa★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Conophytum bilobum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome records18–182n range18median18mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 184×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Hammer, S. & S. Liede. 1992. New chromosome counts in the Conophytinae. Cact. Succ. J. (Los Angeles) 64(4): 197–199.

CCDB · ipcn-api-dl — Albers, F. & R. HAAS. 1978. Karyosystematische Untersuchungen bei den Mesembryanthemaceae Fenzl emend. Herre et Volk. Bot. Jahrb. Syst. 99: 462–467.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type142 records

Wild obs. + sensor120

Museum / vouchered20

Cultivated / captive2

Range

Area of Occupancy AOO536 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy1% within 1 km

≤1 km 1>10 km 119

120 georeferenced

Open the mapobservation + sensor120

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 20 records without

Open the institutions mapphysical evidence20

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Hamburglocation not on record	13
South African National Biodiversity Institute, Compton Herbariumlocation not on record	2
Stockholm, SE	1
Bronx, US	1
South African National Biodiversity Institutelocation not on record	1
Sphaeroid Institutelocation not on record	1

6 institutions · 19 of 20 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Conophytum bilobum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.6 °C 15.0–19.4

Seasonal swing summer↔winter9.40 °C

Max temp (day)21.8 °C 18.9–27.3

Min temp (night)13.4 °C 10.3–13.6

Precipitation13.8 mm/mo 6.50–25.8

Air humidity50.2 % 49.1–60.8

Moisture balance-54.4 mm/mo

Vapour deficit844 Pa 685–1,160

Wind speed4.00 m/s

Cloud cover7.10 % 7.00–12.4

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)