Conocybe velutipes

(Velen.) Hauskn. & Svrček · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Bolbitiaceae/Conocybe

At a glance

Occurrence records356

Data sources10

Biological traits0

DNA specimens4

eDNA detections583

Sources10 archives

Databases and archives Conocybe velutipes's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility356 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI583 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF356 records

Environmental DNA9 datasets · 10 countries583 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Conocybe velutipes is a species of mushroom in the Bolbitiaceae family. It contains the psychedelic alkaloids psilocybin and psilocin.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition1 compounds

Compounds documented for Conocybe velutipes across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Simple indole alkaloids1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
Psilocin		present	LOTUS

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Conocybe velutipes has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes1

GenBank sequences8

eDNA detections583

Countries10

The DNA barcodea real sequence read deposited for this species

ITSPQ741108.1 ↗334 bpPoland · 2023

ACGT

GAACCAGCGGAGGGATCATTACAGAGTAAACTTGGTGGGTTGTTGCTGGCTCTCAATTGAGCATGTGCACGCCTGTCATCTTTATCTTTC …

Conocybe velutipes clone New.CleanUp.ReferenceOTU5515 internal transcribed spacer 1 and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS8

fungal barcode

08Occurrence & distribution

Record type356 records

Wild obs. + sensor255

Museum / vouchered100

Other1

Range

Area of Occupancy AOO1 096 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy24% within 1 km

≤100 m 36≤1 km 19≤10 km 174

229 georeferenced · 26 without coordinates

Open the mapobservation + sensor255

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy94% within 1 km

≤100 m 19≤1 km 31≤10 km 3

53 georeferenced · 47 without coordinates

Open the institutions mapphysical evidence100

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
WU-MYClocation not on record	15
Karlsruhe, DE	12
Olocation not on record	10
	10
Copenhagen, DK	7
Kyiv, UA	4
Kew, GB	3
SLU Artdatabankenlocation not on record	3
Helsinki, FI	3
Salzburg, AT	2
University of Oslo, Natural History Museumlocation not on record	2
Philadelphia, US	2
MeiseBGlocation not on record	2
Gijón, ES	1
Görlitz, DE	1
Tartu, EE	1
Natural History Museum Rotterdamlocation not on record	1
nsnflocation not on record	1
Trondheim, NO	1

19 institutions · 81 of 100 vouchered records shown · 19 without an institution code

09Environmental DNA583 detections

Where the DNA of Conocybe velutipes was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found583

Studies independent surveys9

Countries10

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 583 detections have coordinates

Open the map10 countries0

Middle boreal, pastured meadow; old forest f…PalearcticNearctic

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

Temperature17.0 °C 10.1–29.0

pH6.20 3.30–9.10

Conductivity98.0 µS/cm 10.0–50,700

Organic carbon2.21 % 0.03–8.08

Water content7.49 % 1.68–50.8

Nitrate-N5.00 mg/kg 0.5–86.0

Phosphorus17.0 mg/kg 3.00–193

Clay19.2 % 2.92–69.0

Sand61.7 % 13.2–94.1

Depth0 m 0–1.02

SoilMarineVertosolTenosolKurosolsCalcarosolKurosolHydrosol

201 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.4 °C 10.9–17.9

Seasonal swing summer↔winter12.0 °C

Max temp (day)18.0 °C 15.0–23.4

Min temp (night)9.00 °C 6.10–15.7

Precipitation52.8 mm/mo 21.9–72.0

Air humidity58.2 % 53.8–60.7

Moisture balance-60.5 mm/mo -101–18.1

Vapour deficit647 Pa 507–944

Wind speed3.70 m/s 2.90–5.00

Cloud cover25.4 % 11.8–40.0

CHELSA 1981–2010, ~9 km grid, at location & month of 582 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)