Conocybe moseri

Watling · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Bolbitiaceae/Conocybe

At a glance

Occurrence records212

Data sources9

Biological traits0

DNA specimens5

eDNA detections20

Sources9 archives

Databases and archives Conocybe moseri's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility212 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI20 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF212 records

Environmental DNA4 datasets · 4 countries20 detections

DNA & barcodingBOLD · NCBI5 specimens

01Narrative

Conocybe moseri is a mushroom species in the family Bolbitiaceae. It was described as new to science in 1980 by mycologist Roy Watling, from collections made in France. The specific epithet moseri honours Austrian mycologist Meinhard Moser. The fungus has been reported from the United Kingdom, growing in grassy areas, fields, and edges of woods. In 1995, it was recorded from Switzerland, from Ukraine in 2007, and from Russia in 2007. It was reported from India in 2015, where it was found growing on cattle dung.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Conocybe moseri has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes2

GenBank sequences8

eDNA detections20

Countries4

The DNA barcodea real sequence read deposited for this species

ITSOQ780309.1 ↗639 bp

ACGT

GGAAGGATCATTACAGAGTAAACTTGGTGGGTTGTTGCTGGCTCTCAATTGAGCATGTGCACGCCTGTCATCTTTATCTTTCCACCATGT …

Conocybe moseri voucher HMJAU45075 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS8★ITS1

fungal barcode

08Occurrence & distribution

Record type212 records

Wild obs. + sensor116

Museum / vouchered93

Other3

Range

Area of Occupancy AOO656 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy15% within 1 km

≤100 m 11≤1 km 3≤10 km 81>10 km 1

96 georeferenced · 20 without coordinates

Open the mapobservation + sensor116

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy69% within 1 km

≤100 m 12≤1 km 21≤10 km 14>10 km 1

48 georeferenced · 45 without coordinates

Open the institutions mapphysical evidence93

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
WU-MYClocation not on record	10
Adam Mickiewicz University in Poznańlocation not on record	6
Helsinki, FI	6
Copenhagen, DK	6
Zürich, CH	5
Salzburg, AT	4
GJOlocation not on record	4
Görlitz, DE	4
Karlsruhe, DE	4
BDBClocation not on record	3
Philadelphia, US	3
Kew, GB	3
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	2
Olocation not on record	2
MeiseBGlocation not on record	2
Kyiv, UA	2
SLU Artdatabankenlocation not on record	2
Joensuu, FI	1
WTUlocation not on record	1
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	1
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	1
JA-CAGPDS-CAMlocation not on record	1
nsnflocation not on record	1

23 institutions · 74 of 93 vouchered records shown · 19 without an institution code

09Environmental DNA20 detections

Where the DNA of Conocybe moseri was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found20

Studies independent surveys4

Countries4

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 20 detections have coordinates

Open the map4 countries0

PalearcticIndomalayan

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

Temperature20.5 °C 15.0–26.0

pH6.13 5.00–9.10

Conductivity123 µS/cm 15.0–5,260

Organic carbon1.25 % 0.51–3.03

Water content18.7 % 2.40–18.9

Nitrate-N9.00 mg/kg 2.00–24.0

Phosphorus33.0 mg/kg 5.00–86.0

Clay10.4 % 5.79–61.7

Sand82.7 % 18.4–97.1

Depth0.2 m 0–0.2

SoilRudosolSodosolTenosolVertosolsCalcarosolPodosol

13 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.5 °C 12.1–23.0

Seasonal swing summer↔winter12.1 °C

Max temp (day)18.7 °C 13.5–27.4

Min temp (night)11.5 °C 8.10–18.2

Precipitation53.0 mm/mo 28.3–127

Air humidity57.8 % 50.5–62.5

Moisture balance-49.0 mm/mo -115–16.5

Vapour deficit668 Pa 554–1,187

Wind speed4.30 m/s 2.90–5.10

Cloud cover24.0 % 20.9–59.7

CHELSA 1981–2010, ~9 km grid, at location & month of 16 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)