Conocybe mesospora

Kühner ex Watling · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Bolbitiaceae/Conocybe

At a glance

Occurrence records600

Data sources8

Biological traits0

DNA specimens8

eDNA detections87

Sources8 archives

Databases and archives Conocybe mesospora's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility600 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI87 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF600 records

Environmental DNA4 datasets · 11 countries87 detections

DNA & barcodingBOLD · NCBI8 specimens

01Narrative

Stożkówka ochrowordzawa – gatunek grzybów z rodziny gnojankowatych (Bolbitiaceae).

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Conocybe mesospora has left across the world's sequence archives.

At a glance

DNA specimens8

Marker genes2

GenBank sequences8

eDNA detections87

Countries11

The DNA barcodea real sequence read deposited for this species

ITSPX914076.1 ↗300 bpSwitzerland · 1984

ACGT

AACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAATCTCTACGACTTTGTGTTGTTTAGTA …

Conocybe mesospora var. subalpina voucher F:C0004072F (C-9682) from Switzerland 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS8★ITS1

fungal barcode

08Occurrence & distribution

Record type600 records

Wild obs. + sensor376

Museum / vouchered220

Cultivated / captive1

Other3

Range

Area of Occupancy AOO1 572 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy31% within 1 km

≤100 m 63≤1 km 39≤10 km 218>10 km 5

325 georeferenced · 51 without coordinates

Open the mapobservation + sensor376

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy65% within 1 km

≤100 m 20≤1 km 25≤10 km 21>10 km 3

69 georeferenced · 151 without coordinates

Open the institutions mapphysical evidence220

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions18 of 29 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Karlsruhe, DE	27
Adam Mickiewicz University in Poznańlocation not on record	16
Göteborg, SE	14
SLU Artdatabankenlocation not on record	12
Zürich, CH	10
Kew, GB	9
University of Oslo, Natural History Museumlocation not on record	9
Olocation not on record	9
Uniwersytet Łódzkilocation not on record	8
WU-MYClocation not on record	8
MeiseBGlocation not on record	7
Görlitz, DE	5
Helsinki, FI	4
Turku, FI	2
Uppsala, SE	2
Salzburg, AT	2
Philadelphia, US	2
Chicago, US	2
Trondheim, NO	1
Mlocation not on record	1
BDBClocation not on record	1
V. N. Karazin National Universitylocation not on record	1
Gijón, ES	1
Auckland, NZ	1
Kyiv, UA	1
San Sebastián, ES	1
Toronto, CA	1
Jyväskylä, FI	1
DPIlocation not on record	1

29 institutions · 159 of 220 vouchered records shown · 61 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA87 detections

Where the DNA of Conocybe mesospora was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found87

Studies independent surveys4

Countries11

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 87 detections have coordinates

Open the map11 countries0

Innimellom hoyt gras i stikant i blandinggss…Open forest pasture in southern/middle borea…South boreal, floodplain forest dominated by…NeotropicAfrotropicPalearctic

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.7 °C 5.80–16.9

Seasonal swing summer↔winter22.3 °C

Max temp (day)15.8 °C 8.70–20.4

Min temp (night)10.5 °C 2.80–14.2

Precipitation75.0 mm/mo 58.9–109

Air humidity62.2 % 59.4–66.9

Moisture balance3.70 mm/mo -35.5–71.8

Vapour deficit547 Pa 329–746

Wind speed3.60 m/s 2.10–4.70

Cloud cover44.0 % 37.1–51.4

CHELSA 1981–2010, ~9 km grid, at location & month of 85 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)