Conocybe macrospora

(G.F.Atk.) Hauskn. · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Bolbitiaceae/Conocybe

At a glance

Occurrence records187

Data sources7

Biological traits0

DNA specimens7

eDNA detections9

Sources7 archives

Databases and archives Conocybe macrospora's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility187 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF187 records

Environmental DNA3 datasets · 3 countries9 detections

DNA & barcodingBOLD · NCBI7 specimens

01Narrative

Stożkówka wielkozarodnikowa – gatunek grzybów z rodziny gnojankowatych (Bolbitiaceae).

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Conocybe macrospora has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes1

GenBank sequences8

eDNA detections9

Countries3

The DNA barcodea real sequence read deposited for this species

ITSKT809170.1 ↗339 bp

ACGT

AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACAGAATAAACTTGATAAGTTGTTGCTGGCTCGTAAGAGTATGTG …

Conocybe macrospora strain F141 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, complete sequence; and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS8

fungal barcode

08Occurrence & distribution

Record type187 records

Wild obs. + sensor97

Museum / vouchered84

Other6

Range

Area of Occupancy AOO576 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy53% within 1 km

≤100 m 33≤1 km 14≤10 km 41>10 km 1

89 georeferenced · 8 without coordinates

Open the mapobservation + sensor97

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy88% within 1 km

≤100 m 22≤1 km 13≤10 km 3>10 km 2

40 georeferenced · 44 without coordinates

Open the institutions mapphysical evidence84

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Olocation not on record	13
WU-MYClocation not on record	9
SLU Artdatabankenlocation not on record	8
University of Oslo, Natural History Museumlocation not on record	5
	5
Kyiv, UA	5
Philadelphia, US	4
Helsinki, FI	4
Uppsala, SE	4
Kew, GB	3
Tartu, EE	2
Chicago, US	2
Karlsruhe, DE	2
nsnflocation not on record	2
Bronx, US	1
TENN-Flocation not on record	1
Turku, FI	1
San Sebastián, ES	1
Mlocation not on record	1
Auckland, NZ	1
Natural History Museum Rotterdamlocation not on record	1
Trondheim, NO	1
Copenhagen, DK	1

23 institutions · 77 of 84 vouchered records shown · 7 without an institution code

09Environmental DNA9 detections

Where the DNA of Conocybe macrospora was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys3

Countries3

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map3 countries0

Open meadow with dense growth of Matteuccia …grasmarkNeotropicSouth/middle boreal zone, path border, proba…On horse dung

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.1 °C 10.3–23.5

Seasonal swing summer↔winter19.1 °C

Max temp (day)18.7 °C 12.7–27.3

Min temp (night)10.7 °C 6.50–18.8

Precipitation107 mm/mo 79.8–164

Air humidity60.4 % 56.2–66.0

Moisture balance25.4 mm/mo -53.2–67.0

Vapour deficit720 Pa 450–1,146

Wind speed2.80 m/s 2.40–3.10

Cloud cover44.2 % 30.2–49.0

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)