Conocybe filaris

(Fr.) Kühner · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Bolbitiaceae/Conocybe

At a glance

Occurrence records564

Data sources8

Biological traits0

DNA specimens3

eDNA detections185

Sources8 archives

Databases and archives Conocybe filaris's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility564 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI185 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF564 records

Environmental DNA3 datasets · 3 countries185 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Stożkówka cienkotrzonowa – gatunek grzybów z rodziny gnojankowatych (Bolbitiaceae).

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Conocybe filaris has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes1

GenBank sequences4

eDNA detections185

Countries3

The DNA barcodea real sequence read deposited for this species

ITSMK900745.1 ↗279 bpUSA · 1973

ACGT

CCTGCGGAAGGATCATTACAGAATAAACTTGATGGATTGTAGCTGGCTCTCTCGGGAGTATGTGCACCTCGTCATCTTTATATTTCCACC …

Conocybe filaris internal transcribed spacer 1, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS4

fungal barcode

08Occurrence & distribution

Record type564 records

Wild obs. + sensor466

Museum / vouchered94

Other4

Range

Area of Occupancy AOO1 548 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy9% within 1 km

≤100 m 18≤1 km 22≤10 km 422>10 km 1

463 georeferenced · 3 without coordinates

Open the mapobservation + sensor466

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy52% within 1 km

≤100 m 4≤1 km 10≤10 km 12>10 km 1

27 georeferenced · 67 without coordinates

Open the institutions mapphysical evidence94

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
WTUlocation not on record	13
Kew, GB	8
BDBClocation not on record	7
Karlsruhe, DE	7
Vancouver, CA	6
Adam Mickiewicz University in Poznańlocation not on record	6
Davis and Elkins Collegelocation not on record	3
Copenhagen, DK	3
Görlitz, DE	3
Uppsala, SE	2
Göteborg, SE	2
San Sebastián, ES	2
Philadelphia, US	2
SLU Artdatabankenlocation not on record	2
GJOlocation not on record	2
Toronto, CA	2
LDlocation not on record	2
CA	1
Universidade de Lisboa, Museu Bocagelocation not on record	1
ILLSlocation not on record	1
Bernard Price Institute for Palaeontological Researchlocation not on record	1
Gijón, ES	1
Denver, US	1
TENN-Flocation not on record	1
Royal Ontario Museum, TRTC Fungariumlocation not on record	1
St. Paul, US	1

26 institutions · 81 of 94 vouchered records shown · 13 without an institution code

09Environmental DNA185 detections

Where the DNA of Conocybe filaris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found185

Studies independent surveys3

Countries3

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 185 detections have coordinates

Open the map3 countries0

Growing on very rotted wood (Elm or Walnut)

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

Temperature16.0 °C

pH5.90 3.50–8.80

Conductivity34.0 µS/cm 11.0–1,459

Organic carbon1.57 % 0.006–5.84

Water content16.6 % 0.305–82.9

Nitrate-N4.00 mg/kg 0.152–71.0

Phosphorus9.50 mg/kg 2.00–131

Clay13.2 % 0.93–39.2

Sand76.3 % 33.8–99.1

Depth0 m 0–0.2

SoilChromosolKurosolHydrosolPodosolVertosolCalcarosol

181 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.1 °C 5.00–18.6

Seasonal swing summer↔winter12.0 °C

Max temp (day)17.0 °C 9.10–24.1

Min temp (night)9.00 °C 1.00–14.2

Precipitation89.9 mm/mo 56.6–123

Air humidity58.6 % 56.1–64.2

Moisture balance17.4 mm/mo -38.8–52.6

Vapour deficit629 Pa 311–898

Wind speed2.90 m/s 2.30–4.10

Cloud cover17.4 % 7.60–44.5

CHELSA 1981–2010, ~9 km grid, at location & month of 183 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)