Conocybe aurea

(Jul.Schäff.) Hongo · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Bolbitiaceae/Conocybe

At a glance

Occurrence records421

Data sources8

Biological traits0

DNA specimens6

eDNA detections7

Sources8 archives

Databases and archives Conocybe aurea's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility421 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF421 records

Environmental DNA2 datasets · 3 countries7 detections

DNA & barcodingBOLD · NCBI6 specimens

01Narrative

Conocybe aurea is a basidiomycete fungus in the family Bolbitiaceae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Conocybe aurea has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes2

GenBank sequences9

eDNA detections7

Countries4

The DNA barcodea real sequence read deposited for this species

ITSOR978492.1 ↗627 bpUnited Kingdom · 2023

ACGT

GTAGGTGAACCTGCGGAAGGATCATTACAGAATAAACCTGATGAGTTGTAGCTGGCCCACTCACATGGGCAAGTGCTCACTTGTCGTTTT …

Conocybe aurea voucher NFSG_20230918_01TL small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS9★ITS1

fungal barcode

08Occurrence & distribution

Record type421 records

Wild obs. + sensor367

Museum / vouchered54

Range

Area of Occupancy AOO1 308 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy58% within 1 km

≤100 m 173≤1 km 16≤10 km 115>10 km 22

326 georeferenced · 41 without coordinates

Open the mapobservation + sensor367

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤100 m 4≤1 km 12≤10 km 8

24 georeferenced · 30 without coordinates

Open the institutions mapphysical evidence54

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
WU-MYClocation not on record	12
Uniwersytet Łódzkilocation not on record	6
BDBClocation not on record	3
San Sebastián, ES	3
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	3
Copenhagen, DK	3
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	2
Zürich, CH	1
TENN-Flocation not on record	1
WTUlocation not on record	1
GJOlocation not on record	1
KNAMlocation not on record	1
Tilburg, NL	1
Personal Herbarium of Joanne Schwartzlocation not on record	1

14 institutions · 39 of 54 vouchered records shown · 14 without an institution code

09Environmental DNA7 detections

Where the DNA of Conocybe aurea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys2

Countries3

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map3 countries0

On Compact soil in cultivated Cucumber bed, …

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.6 °C 14.9–20.0

Seasonal swing summer↔winter12.3 °C

Max temp (day)20.4 °C 17.9–25.1

Min temp (night)12.4 °C 11.7–16.6

Precipitation54.6 mm/mo 15.4–83.2

Air humidity62.9 % 62.4–63.3

Moisture balance-27.4 mm/mo -89.4–0.2

Vapour deficit655 Pa 638–866

Wind speed2.30 m/s 1.40–4.20

Cloud cover43.4 % 18.4–44.4

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)