Conoclinium dissectum

A.Gray · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Conoclinium

At a glance

Occurrence records2 095

Data sources11

Biological traits7

DNA specimens2

eDNA detections2

Sources11 archives

Databases and archives Conoclinium dissectum's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 095 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources7 traits

Chemical compositionLOTUS2 compounds

Occurrence & distributionGBIF2 095 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 20

01Narrative

Conoclinium dissectum, the palm-leaf mistflower or palmleaf thoroughwort, is a North American species of flowering plants in the family Asteraceae. It is native to northern Mexico (Tamaulipas, Chihuahua, Coahuila, Durango, Nuevo León, San Luis Potosí, Sonora, Zacatecas) and the southwestern United States (Arizona, Texas, New Mexico).Turner, B. L. 1997. The Comps of Mexico: A systematic account of the family Asteraceae, vol. 1 – Eupatorieae. Phytologia Memoirs 11: i–iv, 1–272 Conoclinium dissectum is a perennial often forming tight clumps. One plant generally produces several flower heads, each with lavender or purple disc florets but no ray florets.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

03Chemical composition2 compounds

Compounds documented for Conoclinium dissectum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Flavones2

Documented compounds2 total

Tissue Source Quantified only

Compound	Class	Amount	Source
5,7,4'-Trihydroxy-6,3',5'-trimethoxyflavone		present	LOTUS
Linderoflavone B		present	LOTUS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Conoclinium dissectum has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes1

GenBank sequences3

eDNA detections2

The DNA barcodea real sequence read deposited for this species

ITSMN556290.1 ↗653 bp

ACGT

TCGAACCCTGCATGGCAGAGCAACCCGTGAACGTGTTTCAACAATACGGCTTTGGCGGGGAATGATGCCTCTATGTTTCAAGCCTCGTGA …

Conoclinium dissectum voucher AC San Jens 6736, TEX internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS3

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Conoclinium dissectum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Chromosome records20–202n range20median20mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 202×CCDB · ipcn-api-dl · CCDB · eflora

CCDB · ipcn-api-dl — Watanabe, K., R. M. King, T. Yahara, M. Ito, J. Yokoyama, T. Suzuki & D. J. Crawford. 1995. Chromosomal cytology and evolution in Eupatorieae (Asteraceae). Ann. Missouri Bot. Gard. 82: 581–592.

CCDB · eflora

n 106×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-ipcn73-74 +1

CCDB · ipcn-api-dl — Powell, A. M. & S. A. POWELL. 1977. Chromosome numbers of gypsophilious plant species of the Chibuahuan Desert. Sida 7: 80–90.

CCDB · ipcn-api-dl — Keil, D. J. & T. F. Stuessy. 1977. Chromosome counts of Compositae from Mexico and the United States. Amer. J. Bot. 64: 791–798.

CCDB · book-ipcn67-71 — POWELL, A.M. & s. SIKES. 1970. Chromosome numbers of some chihuahuan desert Compositae. Southw. Naturalist 15: 175-186.

CCDB · book-ipcn73-74 — URBATSCH, L.E. 1974. In IOPB chromosome number reports XLIV. Taxon 23: 373-380.

CCDB · Cave1963 — Powell & T. 1963

CCDB · Cave1963 — DeJong & Long. 1963

08Occurrence & distribution

Record type2 095 records

Wild obs. + sensor1 920

Museum / vouchered175

Range

Area of Occupancy AOO3 800 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 1 428≤1 km 165≤10 km 49>10 km 80

1 722 georeferenced · 198 without coordinates

Open the mapobservation + sensor1 920

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy83% within 1 km

≤100 m 88≤1 km 2≤10 km 16>10 km 2

108 georeferenced · 67 without coordinates

Open the institutions mapphysical evidence175

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions18 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Austin, US	80
Mexico City, MX	25
Zacatecas, MX	18
Austin, US	12
San Angelo, US	9
Albuquerque, US	5
Guasave, MX	5
Riverside, US	5
Saint Louis, US	2
Durango, MX	2
Hermosillo, MX	2
Lubbock, US	2
Phoenix, US	2
Bangkok, TH	1
Giardini Botanici Hanburylocation not on record	1
Bronx, US	1
EL PASO, US	1
Denver, US	1
Chadron, US	1

19 institutions · 175 of 175 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Conoclinium dissectum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Conoclinium dissectum

At a glance

Sources11 archives

Life cycle & reproduction1

Diet & foraging1

Habitat & environment5

Compound class profile1 class

Documented compounds2 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type2 095 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions18 of 19 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type2 095 records