Conocarpus lancifolius

Engl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Combretaceae/Conocarpus

At a glance

Occurrence records99

Data sources8

Biological traits15

DNA specimens2

eDNA detections1

Sources8 archives

Databases and archives Conocarpus lancifolius's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility99 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources15 traits

Occurrence & distributionGBIF99 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Conocarpus lancifolius, one of two species in the genus Conocarpus, is a tree in the family Combretaceae native to coastal and riverine areas of Somalia, Djibouti, and Yemen. It is found throughout the Horn of Africa, the Arabian peninsula, and South Asia. The tree has no common name in English. In Somali, it is called qalab; in Arabic, the name is damas. It is also commonly found in residential compounds in Dubai.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology4

Plant height15 m

Seed mass1.53 mg

⚠ sources differ — TRY: 1.53 mg · GIFT: 5.76 mg

Seed mass max10 mg

Seed mass min0.62 mg

Life cycle & reproduction3

Deciduousnessevergreen

Life formshrub or tree

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment4

Climateseasonally dry tropical

Climberself-supporting

Growth formtree

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Conocarpus lancifolius has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences3

eDNA detections1

Countries2

The DNA barcodea real sequence read deposited for this species

rbcLJX571811.1 ↗552 bpEgypt · 2010

ACGT

AGTGTTGGATTCAAAGCTGGTGTTAAAGATTATAAACTGACTTATTATACTCCTGACTATCAAACCAAAGATACTGATATCTTGGCAGCA …

Conocarpus lancifolius voucher Hosam00057 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL1★rbcLa

plant barcode

08Occurrence & distribution

Record type99 records

Wild obs. + sensor58

Museum / vouchered37

Cultivated / captive4

Range

Area of Occupancy AOO248 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy27% within 1 km

≤100 m 13≤1 km 1>10 km 38

52 georeferenced · 6 without coordinates

Open the mapobservation + sensor58

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 6

7 georeferenced · 30 without coordinates

Open the institutions mapphysical evidence37

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 4 records without

Open the mapnot free-living4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Berlin, DE	6
Uniwersytet Śląski w Katowicachlocation not on record	5
Kew, GB	5
Edinburgh, GB	4
University of Hargeisalocation not on record	3
Uppsala, SE	3
Stockholm, SE	2
MAlocation not on record	2
Wlocation not on record	2
MeiseBGlocation not on record	1
Alexandria Universitylocation not on record	1
BClocation not on record	1

12 institutions · 35 of 37 vouchered records shown · 2 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Conocarpus lancifolius was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.5 °C 25.5–25.5

Seasonal swing summer↔winter11.3 °C

Max temp (day)26.7 °C

Min temp (night)24.2 °C

Precipitation0.1 mm/mo

Air humidity63.6 %

Vapour deficit1,182 Pa

Cloud cover4.90 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)