Connopus acervatus

(Fr.) K.W.Hughes, Mather & R.H.Petersen · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Omphalotaceae/Connopus

At a glance

Occurrence records2 736

Data sources7

Biological traits0

DNA specimens41

eDNA detections102

Sources7 archives

Databases and archives Connopus acervatus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 736 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI102 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics41 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 736 records

Environmental DNA5 datasets · 8 countries102 detections

DNA & barcodingBOLD · NCBI41 specimens

01Narrative

Pieniążek kępkowy, łysostopek kępkowy – gatunek grzybów należący do rodziny Omphalotaceae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding41 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Connopus acervatus has left across the world's sequence archives.

At a glance

DNA specimens41

Marker genes1

GenBank sequences10

eDNA detections102

Countries8

The DNA barcodea real sequence read deposited for this species

ITSPZ271778.1 ↗376 bpUSA · 1937

ACGT

GAACGCACCTTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTTGAGTGTCATTAAATTATCAACTTTATCAGGTTTTTATTAACTTGT …

Connopus acervatus isolate MICH CIB A. H. Smith 8856 voucher MICH:166316 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

08Occurrence & distribution

Record type2 736 records

Wild obs. + sensor2 495

Museum / vouchered220

Other21

Range

Area of Occupancy AOO7 352 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 832≤1 km 1 218≤10 km 266>10 km 70

2 386 georeferenced · 109 without coordinates

Open the mapobservation + sensor2 495

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy76% within 1 km

≤100 m 32≤1 km 58≤10 km 25>10 km 4

119 georeferenced · 101 without coordinates

Open the institutions mapphysical evidence220

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 29 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Olocation not on record	40
TENN-Flocation not on record	24
Trondheim, NO	20
Toronto, CA	18
SLU Artdatabankenlocation not on record	11
Denver, US	7
IB FRC Komi SC UB RASlocation not on record	6
Acadia Universitylocation not on record	5
Philadelphia, US	4
Göteborg, SE	4
University of Oslo, Natural History Museumlocation not on record	4
Kyiv, UA	3
Cincinnati, US	3
National Mushroom Centre, Department of Agriculture, Ministry of Agriculture and Livestock, Bhutanlocation not on record	2
Salzburg, AT	2
TROMlocation not on record	2
Tartu, EE	2
Bardejov, SK	2
Vancouver, CA	2
BDBClocation not on record	2
Karlsruhe, DE	2
Personal Herbarium of Bitty Roylocation not on record	1
WTUlocation not on record	1
Rene Pomerleau Herbariumlocation not on record	1
Chicago, US	1
Royal Ontario Museum, TRTC Fungariumlocation not on record	1
WU-MYClocation not on record	1
nsnflocation not on record	1
Copenhagen, DK	1

29 institutions · 173 of 220 vouchered records shown · 33 without an institution code

09Environmental DNA102 detections

Where the DNA of Connopus acervatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found102

Studies independent surveys5

Countries8

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 102 detections have coordinates

Open the map8 countries0

Spruce-hemlock forest with scattered cottonw…TourbiereMixed forest near pond, on wood in depressionPalearctic

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.7 °C 2.50–13.9

Seasonal swing summer↔winter24.8 °C

Max temp (day)16.8 °C 6.80–17.5

Min temp (night)9.20 °C -0.7–10.4

Precipitation77.9 mm/mo 61.7–93.7

Air humidity57.7 % 57.5–65.4

Moisture balance-25.2 mm/mo -30.3–35.6

Vapour deficit665 Pa 330–677

Wind speed2.50 m/s 2.40–3.10

Cloud cover47.9 % 45.1–54.6

CHELSA 1981–2010, ~9 km grid, at location & month of 81 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Connopus acervatus

At a glance

Sources7 archives

At a glance

Record type2 736 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions14 of 29 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 736 records