Connarus conchocarpus

F.Muell. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Oxalidales/Connaraceae/Connarus

At a glance

Occurrence records40

Data sources6

Biological traits19

DNA specimens3

eDNA detections3

Sources6 archives

Databases and archives Connarus conchocarpus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility40 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources19 traits

Occurrence & distributionGBIF40 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Connarus conchocarpus là một loài thực vật có hoa trong họ Connaraceae. Loài này được F.Muell. mô tả khoa học đầu tiên năm 1866.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology7

Fruit length27.5 mm

Fruit width20 mm

Leaf length150 mm

Leaf size2 646 mm²

Leaf width54 mm

Seed length16 mm

Seed width12 mm

Life cycle & reproduction5

Deciduousnessevergreen

Dispersal typeanimal

Flowering timennnnnyyyyyyy

Life spanperennial

Sex typehermaphrodite

Habitat & environment7

Climateseasonally dry tropical

Climberobligatory

Fruit fleshinessdry

Fruit typefollicle

Growth formclimber

Leaf compoundnesscompound

Woodinesswoody

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Connarus conchocarpus has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes2

GenBank sequences3

eDNA detections3

The DNA barcodea real sequence read deposited for this species

rbcLU06798.1 ↗1 398 bp

ACGT

GTTGGATTCAAGGCTGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGACTATGAAACCAAAGATACTGATATCTTGGCAGCATTC …

Connarus conchocarpus ribulose-bisphosphate carboxylase large subunit (rbcL), partial cds; chloroplast gene for chloroplast product

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2

plant barcode

08Occurrence & distribution

Record type40 records

Wild obs. + sensor14

Museum / vouchered24

Other2

Origin

Native3

Range

Area of Occupancy AOO116 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 5≤1 km 6≤10 km 1>10 km 1

13 georeferenced · 1 without coordinates

Open the mapobservation + sensor14

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy23% within 1 km

≤100 m 2≤1 km 1≤10 km 9>10 km 1

13 georeferenced · 11 without coordinates

Open the institutions mapphysical evidence24

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Palmerston, AU	4
Mount Annan, AU	3
Canberra, AU	3
Adelaide, AU	2
Museo Entomologico de Leonlocation not on record	1
Kew, GB	1
Honolulu, US	1
Armidale, AU	1

8 institutions · 16 of 24 vouchered records shown · 8 without an institution code

09Environmental DNA3 detections

Where the DNA of Connarus conchocarpus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)