Coniochaeta velutina

(Fuckel) Cooke · species

image placeholder — illustration coming later

Fungi/Ascomycota/Sordariomycetes/Coniochaetales/Coniochaetaceae/Coniochaeta

At a glance

Occurrence records106

Data sources7

Biological traits0

DNA specimens15

eDNA detections23

Sources7 archives

Databases and archives Coniochaeta velutina's data was compiled from.

GBIFGlobal Biodiversity Information Facility106 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI23 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF106 records

Environmental DNA4 datasets · 4 countries23 detections

DNA & barcodingBOLD · NCBI15 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Coniochaeta velutina has left across the world's sequence archives.

At a glance

DNA specimens15

Marker genes2

GenBank sequences10

eDNA detections23

Countries6

The DNA barcodea real sequence read deposited for this species

ITSPV730330.1 ↗509 bpBrazil · 2021

ACGT

CCGTAGGTGAACCTGCGGAGGGATCATTATTAGAAGCCGAAAGGCTACTTAAAACCATCGCGAACTCGTCCAAGTTGCTTCGGCGGCGCG …

Coniochaeta velutina isolate SG14 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1

fungal barcode

08Occurrence & distribution

Record type106 records

Wild obs. + sensor62

Museum / vouchered43

Cultivated / captive1

Range

Area of Occupancy AOO368 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy33% within 1 km

≤100 m 6≤1 km 13≤10 km 37>10 km 1

57 georeferenced · 5 without coordinates

Open the mapobservation + sensor62

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy56% within 1 km

≤100 m 4≤1 km 6≤10 km 5>10 km 3

18 georeferenced · 25 without coordinates

Open the institutions mapphysical evidence43

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
BDBClocation not on record	9
Uppsala, SE	5
WU-MYClocation not on record	3
TROMlocation not on record	2
Kew, GB	2
San Sebastián, ES	2
MeiseBGlocation not on record	2
SLU Artdatabankenlocation not on record	2
Auckland, NZ	2
ILLSlocation not on record	2
Olocation not on record	1
Tartu, EE	1
Gijón, ES	1
Copenhagen, DK	1
Tilburg, NL	1

15 institutions · 36 of 43 vouchered records shown · 7 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA23 detections

Where the DNA of Coniochaeta velutina was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found23

Studies independent surveys4

Countries4

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 23 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

pH6.20 5.40–7.89

Conductivity172 µS/cm 59.0–83,900

Organic carbon3.78 % 3.11–3.88

Water content17.5 % 13.2–19.6

Nitrate-N43.0 mg/kg 4.00–50.0

Phosphorus165 mg/kg 113–193

Clay10.6 % 9.44–14.9

Sand82.1 % 76.5–82.9

Depth0 m

SoilKandosolChromosol

4 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.7 °C 12.8–24.6

Seasonal swing summer↔winter12.4 °C

Max temp (day)25.5 °C 18.2–28.9

Min temp (night)14.0 °C 8.30–20.1

Precipitation116 mm/mo 92.4–339

Air humidity60.5 % 54.7–62.7

Moisture balance-30.4 mm/mo -49.6–212

Vapour deficit1,020 Pa 665–1,173

Wind speed2.70 m/s 2.40–4.10

Cloud cover25.3 % 23.0–46.5

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)