Coniochaeta polymorpha

Z.U.Khan, Guarro & Suh.Ahmad · species

image placeholder — illustration coming later

Fungi/Ascomycota/Sordariomycetes/Coniochaetales/Coniochaetaceae/Coniochaeta

At a glance

Occurrence records12

Data sources5

Biological traits0

DNA specimens0

eDNA detections298

Sources5 archives

Databases and archives Coniochaeta polymorpha's data was compiled from.

GBIFGlobal Biodiversity Information Facility12 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI298 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF12 records

Environmental DNA7 datasets · 16 countries298 detections

DNA & barcodingNCBIsequences

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Coniochaeta polymorpha has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences9

eDNA detections298

Countries16

The DNA barcodea real sequence read deposited for this species

ITSPQ066162.1 ↗473 bp

ACGT

GCGGGCGTCCCCTCCCTGGGGACGCTGGCCCCCTCGGGGGCTGCCCGCCGGAGCGCCAAAAACTATTCTGTATTTTAGTGGCCTCTCTGA …

Coniochaeta polymorpha strain CpK1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS9

fungal barcode

08Occurrence & distribution

Record type12 records

Museum / vouchered12

Range

Area of Occupancy AOO44 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 12 records without

Open the institutions mapphysical evidence12

09Environmental DNA298 detections

Where the DNA of Coniochaeta polymorpha was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found298

Studies independent surveys7

Countries16

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 298 detections have coordinates

Open the map16 countries0

NearcticPalearcticAfrotropic

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

Temperature21.0 °C 11.0–29.0

pH6.40 4.00–9.10

Conductivity91.0 µS/cm 10.0–88,800

Organic carbon1.38 % 0.21–6.44

Water content9.10 % 0.363–103

Nitrate-N4.00 mg/kg 1.00–55.0

Phosphorus21.5 mg/kg 2.00–133

Clay14.9 % 0.97–49.5

Sand76.0 % 24.6–97.1

Depth0 m 0–0.2

SoilMarineVertosolTenosolPodosolChromosolKurosolCalcarosol

53 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.4 °C 9.40–25.1

Seasonal swing summer↔winter19.7 °C

Max temp (day)24.4 °C 14.5–32.9

Min temp (night)13.9 °C 4.50–17.1

Precipitation21.7 mm/mo 1.90–81.9

Air humidity45.1 % 39.2–58.5

Moisture balance-117 mm/mo -215–-7.30

Vapour deficit1,038 Pa 529–1,936

Wind speed4.30 m/s 2.20–4.60

Cloud cover19.4 % 15.2–34.6

CHELSA 1981–2010, ~9 km grid, at location & month of 291 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)