Coniochaeta mutabilis — The Life Data

Fungi/Ascomycota/Sordariomycetes/Coniochaetales/Coniochaetaceae/Coniochaeta

At a glance

Occurrence records98

Data sources6

Biological traits0

DNA specimens8

eDNA detections82

Sources6 archives

Databases and archives Coniochaeta mutabilis's data was compiled from.

GBIFGlobal Biodiversity Information Facility98 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI82 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF98 records

Environmental DNA5 datasets · 30 countries82 detections

DNA & barcodingBOLD · NCBI8 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Coniochaeta mutabilis has left across the world's sequence archives.

At a glance

DNA specimens8

Marker genes2

GenBank sequences9

eDNA detections82

Countries30

The DNA barcodea real sequence read deposited for this species

ITSPP573714.1 ↗403 bp

ACGT

AACCGAAAACTCTGAATTAAATGTCGTCTGAGTACTATGTAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAG …

Coniochaeta mutabilis isolate T26C15 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS9ITS1

fungal barcode

08Occurrence & distribution

Record type98 records

Museum / vouchered98

Range

Area of Occupancy AOO292 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 98 records without

Open the institutions mapphysical evidence98

09Environmental DNA82 detections

Where the DNA of Coniochaeta mutabilis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found82

Studies independent surveys5

Countries30

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 82 detections have coordinates

Open the map30 countries0

PalearcticNeotropicAustralasiaNearcticIndomalayanriver water

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median5.90 °C -3.00–13.3

Seasonal swing summer↔winter20.7 °C

Max temp (day)9.50 °C -0.7–15.6

Min temp (night)1.60 °C -5.40–8.10

Precipitation79.8 mm/mo 46.8–186

Air humidity63.0 % 57.9–67.1

Moisture balance17.3 mm/mo -10.5–101

Vapour deficit391 Pa 225–615

Wind speed2.90 m/s 1.80–5.50

Cloud cover45.4 % 28.0–57.6

CHELSA 1981–2010, ~9 km grid, at location & month of 72 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.