Coniochaeta luteoviridis — The Life Data

Fungi/Ascomycota/Sordariomycetes/Coniochaetales/Coniochaetaceae/Coniochaeta

At a glance

Occurrence records74

Data sources6

Biological traits0

DNA specimens3

eDNA detections1 028

Sources6 archives

Databases and archives Coniochaeta luteoviridis's data was compiled from.

GBIFGlobal Biodiversity Information Facility74 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 028 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF74 records

Environmental DNA6 datasets · 22 countries1 028 detections

DNA & barcodingBOLD · NCBI3 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Coniochaeta luteoviridis has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes1

GenBank sequences9

eDNA detections1 028

Countries22

The DNA barcodea real sequence read deposited for this species

ITSOQ216427.1 ↗486 bpRussia

ACGT

AGGGATCATTATTTAGAAGCCGGAAAGGCCTACTTAAAAACCATCGCGGAACTCCATCCCAAGTTGCTTCGGCGGTTGCGGCGTTCCCTC …

Coniochaeta luteoviridis isolate 69-6-20B internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS9

fungal barcode

08Occurrence & distribution

Record type74 records

Museum / vouchered74

Range

Area of Occupancy AOO16 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 74 records without

Open the institutions mapphysical evidence74

09Environmental DNA1 028 detections

Where the DNA of Coniochaeta luteoviridis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1 028

Studies independent surveys6

Countries22

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 028 detections have coordinates

Open the map22 countries0

Birch sphagnum forestTreed pine-dwarfshrubs-sphagnum ombrotrophic…butterConiferous forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median28.2 °C 11.1–28.2

Seasonal swing summer↔winter2.60 °C

Max temp (day)32.2 °C 14.9–32.2

Min temp (night)24.8 °C 6.50–24.8

Precipitation76.2 mm/mo 62.8–402

Air humidity59.7 % 58.9–71.0

Moisture balance-82.0 mm/mo -82.0–272

Vapour deficit1,541 Pa 493–1,541

Wind speed1.50 m/s 1.50–3.40

Cloud cover29.3 % 27.4–44.5

CHELSA 1981–2010, ~9 km grid, at location & month of 1 019 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.