Coniochaeta lignicola — The Life Data

Fungi/Ascomycota/Sordariomycetes/Coniochaetales/Coniochaetaceae/Coniochaeta

At a glance

Occurrence records8

Data sources6

Biological traits0

DNA specimens7

eDNA detections15

Sources6 archives

Databases and archives Coniochaeta lignicola's data was compiled from.

GBIFGlobal Biodiversity Information Facility8 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF8 records

Environmental DNA4 datasets · 5 countries15 detections

DNA & barcodingBOLD · NCBI7 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Coniochaeta lignicola has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes2

GenBank sequences9

eDNA detections15

Countries5

The DNA barcodea real sequence read deposited for this species

ITSMZ567882.1 ↗209 bp

ACGT

TTATTAGAAGCCGAAAGGCTACTTAAAACCATCGCGAACTCATCCAAGTTGCTTCGGCGGCGCGGCGTCCCTCACGGGGCGCCGCAGCCC …

Coniochaeta lignicola clone SH2098710.08FU internal transcribed spacer 1 and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS9ITS1

fungal barcode

08Occurrence & distribution

Record type8 records

Museum / vouchered8

Range

Area of Occupancy AOO28 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 8 records without

Open the institutions mapphysical evidence8

09Environmental DNA15 detections

Where the DNA of Coniochaeta lignicola was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found15

Studies independent surveys4

Countries5

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 15 detections have coordinates

Open the map5 countries0

PalearcticAustralasia

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.1 °C -0.2–15.4

Seasonal swing summer↔winter12.1 °C

Max temp (day)12.7 °C 2.30–18.2

Min temp (night)7.40 °C -3.10–12.6

Precipitation73.7 mm/mo 51.3–286

Air humidity64.0 % 62.5–70.5

Moisture balance16.5 mm/mo

Vapour deficit462 Pa 295–581

Wind speed2.70 m/s

Cloud cover49.8 % 43.1–54.8

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.