Coniochaeta fasciculata

(J.F.H.Beyma) Z.U.Khan, Gené & Guarro · species

image placeholder — illustration coming later

Fungi/Ascomycota/Sordariomycetes/Coniochaetales/Coniochaetaceae/Coniochaeta

At a glance

Occurrence records43

Data sources6

Biological traits0

DNA specimens8

eDNA detections2 702

Sources6 archives

Databases and archives Coniochaeta fasciculata's data was compiled from.

GBIFGlobal Biodiversity Information Facility43 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 702 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF43 records

Environmental DNA10 datasets · 34 countries2 702 detections

DNA & barcodingBOLD · NCBI8 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Coniochaeta fasciculata has left across the world's sequence archives.

At a glance

DNA specimens8

Marker genes2

GenBank sequences9

eDNA detections2 702

Countries34

The DNA barcodea real sequence read deposited for this species

ITSPV544482.1 ↗506 bpChina · 2023

ACGT

TAAACCATCGCGAACTTATCCAAGTTGCTTCGGCGGCGCGGCTCCCCTCACGGGGGACCGCAGCCCCCGCCTCTCAGGAGGTAAGGGGCA …

Coniochaeta fasciculata strain K891 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS9★ITS1

fungal barcode

08Occurrence & distribution

Record type43 records

Wild obs. + sensor15

Museum / vouchered27

Cultivated / captive1

Range

Area of Occupancy AOO116 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 15 records without

Open the mapobservation + sensor15

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 27 records without

Open the institutions mapphysical evidence27

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	4

1 institutions · 4 of 27 vouchered records shown · 23 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 702 detections

Where the DNA of Coniochaeta fasciculata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2 702

Studies independent surveys10

Countries34

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 702 detections have coordinates

Open the map34 countries0

IndomalayanbutterPalearcticAfrotropicNeotropic

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

Temperature18.0 °C 7.00–40.0

pH5.50 3.10–8.70

Conductivity47.0 µS/cm 6.00–102,950

Organic carbon2.07 % 0.004–16.3

Water content20.5 % 0–85.3

Nitrate-N6.00 mg/kg 1.00–148

Phosphorus15.0 mg/kg 2.00–590

Clay13.0 % 0.91–55.1

Sand78.0 % 11.0–97.1

Depth0 m 0–0.2

SoilChromosolVertosolPodosolKurosolTenosolCalcarosol

441 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.0 °C 12.7–22.6

Seasonal swing summer↔winter8.40 °C

Max temp (day)17.7 °C 16.6–27.2

Min temp (night)13.1 °C 8.00–18.0

Precipitation238 mm/mo 22.5–347

Air humidity62.6 % 52.4–65.9

Moisture balance178 mm/mo -118–178

Vapour deficit636 Pa 574–1,148

Wind speed3.00 m/s 2.40–4.30

Cloud cover31.4 % 9.30–40.0

CHELSA 1981–2010, ~9 km grid, at location & month of 2 692 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)