Coniochaeta decumbens

(J.F.H.Beyma) Z.U.Khan, Gené & Guarro · species

image placeholder — illustration coming later

Fungi/Ascomycota/Sordariomycetes/Coniochaetales/Coniochaetaceae/Coniochaeta

At a glance

Occurrence records23

Data sources5

Biological traits0

DNA specimens0

eDNA detections1 132

Sources5 archives

Databases and archives Coniochaeta decumbens's data was compiled from.

GBIFGlobal Biodiversity Information Facility23 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 132 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF23 records

Environmental DNA8 datasets · 31 countries1 132 detections

DNA & barcodingNCBIsequences

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Coniochaeta decumbens has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences7

eDNA detections1 132

Countries31

The DNA barcodea real sequence read deposited for this species

ITSMZ567894.1 ↗202 bp

ACGT

TTACAGAGTTCTAAAAGACTCCCAAAACCATTGTGAACGTACCCGTCAGCGTTGCCTCGGCGGGCGGCCCCTCCCTGGGGCCGCTGCCTC …

Coniochaeta decumbens clone SH1645096.08FU internal transcribed spacer 1 and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS7

fungal barcode

08Occurrence & distribution

Record type23 records

Museum / vouchered23

Range

Area of Occupancy AOO76 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 23 records without

Open the institutions mapphysical evidence23

09Environmental DNA1 132 detections

Where the DNA of Coniochaeta decumbens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1 132

Studies independent surveys8

Countries31

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 132 detections have coordinates

Open the map31 countries0

PalearcticAfrotropicAustralasiaNeotropicNearcticTreed pine-dwarfshrubs-sphagnum ombrotrophic…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

Temperature17.0 °C 7.00–40.0

pH5.60 3.80–9.00

Conductivity33.0 µS/cm 10.0–14,020

Organic carbon1.41 % 0.004–5.52

Water content11.3 % 0.721–85.3

Nitrate-N4.00 mg/kg 0.644–49.7

Phosphorus9.00 mg/kg 2.00–99.0

Clay12.1 % 0.93–61.8

Sand79.2 % 24.5–99.1

Depth0 m 0–0.2

SoilTenosolPodosolKurosolCalcarosolVertosolsChromosol

164 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.7 °C 4.00–21.9

Seasonal swing summer↔winter10.7 °C

Max temp (day)16.6 °C 7.70–26.8

Min temp (night)9.20 °C 0.1–17.2

Precipitation108 mm/mo 23.0–439

Air humidity62.5 % 51.5–67.0

Moisture balance29.3 mm/mo -119–345

Vapour deficit580 Pa 270–945

Wind speed3.00 m/s 1.50–4.70

Cloud cover40.3 % 13.0–55.9

CHELSA 1981–2010, ~9 km grid, at location & month of 1 115 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)