Condylocarpon amazonicum

(Markgr.) Ducke · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Apocynaceae/Condylocarpon

At a glance

Occurrence records92

Data sources6

Biological traits15

DNA specimens1

eDNA detections1

Sources6 archives

Databases and archives Condylocarpon amazonicum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility92 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources15 traits

Occurrence & distributionGBIF92 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Condylocarpon amazonicum là một loài thực vật có hoa trong họ La bố ma. Loài này được (Markgr.) Ducke mô tả khoa học đầu tiên năm 1943.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction4

Deciduousnessevergreen

Dispersal typewind

Life formclimber

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatewet tropical

Climberobligatory

Epiphyteterrestrial

Growth formclimber

Habitat GIFTFloresta de Igapó, Floresta de Várzea

Woodinessvariable

Physiology & chemistry3

Leaf C:N ratio21.79 g/g

Leaf c462 mg/g

Leaf n21.2 mg/g

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Condylocarpon amazonicum has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

matKDQ837537.1 ↗1 476 bp

ACGT

CAACTCACCTTTCTATATCCACTTATCTTTCAGGAGTATATTTATGCACTTGCTCATGACCGTAGTTTAAACCGAGCTATTTTGTTGGAA …

Condylocarpon amazonicum maturase K (matK) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1

plant barcode

08Occurrence & distribution

Record type92 records

Wild obs. + sensor4

Museum / vouchered88

Origin

Native7

Range

Area of Occupancy AOO176 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 3

3 georeferenced · 1 without coordinates

Open the mapobservation + sensor4

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced · 87 without coordinates

Open the institutions mapphysical evidence88

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	28
Chicago, US	13
Kew, GB	9
Tampa, US	6
University of Stellenboschlocation not on record	5
Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record	4
Saint Louis, US	3
Laboratorio de Ictiologialocation not on record	2
UFAClocation not on record	2
Stockholm, SE	1
Museum of Zoologylocation not on record	1
Museu Paraense Emílio Goeldilocation not on record	1
Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record	1
Collections de la Faculte des Sciences de Lyonlocation not on record	1
USP-IBlocation not on record	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
UNICAMPlocation not on record	1
Cambridge, US	1

18 institutions · 81 of 88 vouchered records shown · 7 without an institution code

09Environmental DNA1 detections

Where the DNA of Condylocarpon amazonicum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)