Condica vecors

Guenée, 1852 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Condica

At a glance

Occurrence records2 007

Data sources7

Biological traits0

DNA specimens38

eDNA detections39

Sources7 archives

Databases and archives Condica vecors's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 007 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI39 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics38 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 007 records

Environmental DNA1 datasets · 2 countries39 detections

DNA & barcodingBOLD38 specimens

01Narrative

Condica vecors, the dusky groundling, is a moth of the family Noctuidae. The species was first described by Achille Guenée in 1852. It is found from Newfoundland to Florida, west to Arizona and north to Ontario. The wingspan is 29–38 mm. Adults have mottled dark brown and black forewings. The hindwings are greyish brown with a conspicuous whitish fringe. They are on wing from May to August in the north and from April to October in the south. There are two generations per year. The larvae feed on Eupatorium and lettuce.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding38 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Condica vecors has left across the world's sequence archives.

At a glance

DNA specimens38

BINs1

Marker genes2

eDNA detections39

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus37 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

AACATTATATTTTATTTTTGGAATTTGAGCTGGAATAGTAGGAACTTCATTAAGTTTATTAATTCGAGCTGAATTAGGTACCCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.02%

Haplotypes4

BIN1

Most divergent pair0.30%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Condica vacillanssame genus4.3%Condica roxanasame genus4.6%Condica leucorenasame genus4.7%Condica circuitasame genus5.0%Condica albigerasame genus5.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type2 007 records

Wild obs. + sensor1 603

Museum / vouchered404

Range

Area of Occupancy AOO4 132 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 857≤1 km 235≤10 km 81>10 km 152

1 325 georeferenced · 278 without coordinates

Open the mapobservation + sensor1 603

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy28% within 1 km

≤100 m 9≤1 km 75≤10 km 194>10 km 21

299 georeferenced · 105 without coordinates

Open the institutions mapphysical evidence404

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mississippi State, US	105
New Haven, US	78
East Lansing, US	70
King Saud Universitylocation not on record	66
Georgia Museum of Natural Historylocation not on record	11
University of Alberta Museums (UAM)location not on record	10
St. Paul, US	9
CUlocation not on record	8
ASUlocation not on record	4
OSUClocation not on record	3
Decorah, US	2
University of Guelph, Centre for Biodiversity Genomicslocation not on record	2
UDlocation not on record	2
Philadelphia, US	2
SOVTlocation not on record	2
San Diego, US	1
Colorado State Universitylocation not on record	1
Cleveland Museum of Natural History, OH (CLEV)location not on record	1
Centre for Biodiversity Genomicslocation not on record	1
Toronto, CA	1
UKY-HIClocation not on record	1
North Carolina State University Insect Museumlocation not on record	1
Champaign, US	1
University of Central Floridalocation not on record	1

24 institutions · 383 of 404 vouchered records shown · 21 without an institution code

09Environmental DNA39 detections

Where the DNA of Condica vecors was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found39

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 39 detections have coordinates

Open the map2 countries0

ForestUrban

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.6 °C 13.4–24.9

Seasonal swing summer↔winter25.5 °C

Max temp (day)22.8 °C 18.6–29.6

Min temp (night)13.2 °C 8.10–20.6

Precipitation112 mm/mo 89.0–140

Air humidity57.7 % 54.5–61.8

Moisture balance-27.2 mm/mo -58.6–12.8

Vapour deficit833 Pa 688–1,231

Wind speed3.20 m/s 1.80–5.40

Cloud cover40.9 % 28.5–48.6

CHELSA 1981–2010, ~9 km grid, at location & month of 35 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Condica vecors

At a glance

Sources7 archives

At a glance

Record type2 007 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 24 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 007 records