Condica mobilis

Walker · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Condica

At a glance

Occurrence records959

Data sources5

Biological traits0

DNA specimens110

eDNA detections110

Sources5 archives

Databases and archives Condica mobilis's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility959 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI110 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics110 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF959 records

Environmental DNA1 datasets · 9 countries110 detections

DNA & barcodingBOLD110 specimens

01Narrative

Condica mobilis, the Mobile groundling, is a species of moth in the family Noctuidae (the owlet moths). The MONA or Hodges number for Condica mobilis is 9693.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding110 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Condica mobilis has left across the world's sequence archives.

At a glance

DNA specimens110

BINs2

Marker genes1

eDNA detections110

Countries10

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus109 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 1 variable positions, in barcode order

400Tvariable

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCATTAAGTTTATTAATTCGAGCTGAATTAGGAACACCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.40%

Haplotypes12

BINs2

Most divergent pair7.1%

N.AmericaS.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Condica circuitasame genus3.5%Chaograptis crystallodessame family3.8%Chaograptis rhaptinasame family3.8%Simyra dentinosasame family4.1%Condica dolorosasame genus4.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type959 records

Wild obs. + sensor519

Museum / vouchered440

Range

Area of Occupancy AOO1 732 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 255≤1 km 83≤10 km 42>10 km 48

428 georeferenced · 91 without coordinates

Open the mapobservation + sensor519

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy23% within 1 km

≤100 m 10≤1 km 21≤10 km 65>10 km 36

132 georeferenced · 308 without coordinates

Open the institutions mapphysical evidence440

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	218
New Haven, US	70
Mississippi State, US	50
CUlocation not on record	31
Cleveland Museum of Natural History, OH (CLEV)location not on record	6
San Francisco, US	5
Tapachula, MX	4
Decorah, US	4
Georgia Museum of Natural Historylocation not on record	4
East Lansing, US	3
Albuquerque, US	2
ZSMlocation not on record	2
The University of the West Indies, Trinidad and Tobagolocation not on record	2
NHMOlocation not on record	2
University of Pennsylvanialocation not on record	1
Colorado State Universitylocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1
ASUlocation not on record	1

18 institutions · 407 of 440 vouchered records shown · 33 without an institution code

09Environmental DNA110 detections

Where the DNA of Condica mobilis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found110

Studies independent surveys1

Countries9

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 110 detections have coordinates

Open the map9 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.7 °C 20.0–26.4

Seasonal swing summer↔winter2.50 °C

Max temp (day)27.0 °C 22.5–29.7

Min temp (night)20.8 °C 16.0–24.1

Precipitation135 mm/mo 31.2–345

Air humidity65.5 % 58.7–70.2

Moisture balance20.0 mm/mo

Vapour deficit947 Pa 853–1,275

Wind speed3.30 m/s

Cloud cover32.0 % 15.2–55.2

CHELSA 1981–2010, ~9 km grid, at location & month of 109 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)