Condea verticillata

(Jacq.) Harley & J.F.B.Pastore · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Lamiaceae/Condea

At a glance

Occurrence records826

Data sources11

Biological traits12

DNA specimens0

eDNA detections1

Sources11 archives

Databases and archives Condea verticillata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility826 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

dukesphytochemcompounds

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Chemical compositionDukesPhytochem · LOTUS · NPASS45 compounds

Occurrence & distributionGBIF826 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingNCBIsequences

01Narrative

Condea verticillata, commonly known as John Charles, is a species of flowering plant in the family Lamiaceae. It is found in Mexico, Florida, Central America, the Caribbean, and northwestern South America. It has also been introduced to Hawaii. John Charles is used in traditional medicine to treat a variety of conditions including coughs, colds, fever, tonsillitis, bronchitis, uterine fibroids, skin infections, and stomach ache. The leaf and stem of the plant contain the lignan podophyllotoxin.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formsubshrub or shrub

Life spanperennial

Lifeform raunkiaer detailedchamaephyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Elevation max1 000 m

Elevation min0 m

Epiphyteterrestrial

Growth formshrub

⚠ sources differ — GIFT: shrub · TRY: Herb

Woodinesswoody

03Chemical composition45 compounds

Compounds documented for Condea verticillata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

💊 Medicinal use documented

Compound class profile5 classes

Arylnaphthalene and aryltetralin lignans24

Germacrane sesquiterpenoids6

Arylnaphthalene and aryltetralin lignans $ Dibenzylbutyrolactone lignans2

Oleanane triterpenoids2

Dibenzylbutyrolactone lignans2

Documented compounds45 total

Tissue Source Quantified only

Compound	Class	Amount	Source
PODOPHYLLOTOXIN		500 ppm	DukesPhytochem

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Condea verticillata has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences3

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSJF301551.1 ↗712 bp

ACGT

TCGCGAGAAGTCCATTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCG …

Hyptis verticillata isolate FS36732 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type826 records

Wild obs. + sensor180

Museum / vouchered645

Cultivated / captive1

Range

Area of Occupancy AOO2 320 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 142≤1 km 6≤10 km 7>10 km 8

163 georeferenced · 17 without coordinates

Open the mapobservation + sensor180

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy57% within 1 km

≤1 km 4≤10 km 2>10 km 1

7 georeferenced · 638 without coordinates

Open the institutions mapphysical evidence645

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions26 of 44 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Saint Louis, US	360
Kew, GB	51
Tampa, US	46
Durham, US	31
León, NI	25
University of Stellenboschlocation not on record	13
MEXUlocation not on record	12
St. Augustine, TT	7
San José, CR	7
Aarhus, DK	6
Antiguo Cuscatlán, SV	6
Quito, EC	6
Mexico City, MX	4
BISHlocation not on record	4
Chicago, US	4
BMlocation not on record	4
Madison, US	4
Guatemala City, GT	3
Universidad Nacional Agrarialocation not on record	3
Berlin, DE	3
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	2
COLlocation not on record	2
Managua, NI	2
Sangmiung Universitylocation not on record	2
Wuzhou, CN	2
Chapel Hill, US	1
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	1
Montréal, CA	1
Jena Microbial Resource Collectionlocation not on record	1
LGlocation not on record	1
Río Palenque Science Centerlocation not on record	1
Bronx, US	1
Universidad Nacional Autónoma de Honduraslocation not on record	1
Cambridge, US	1
Riverside, US	1
Mérida, MX	1
HUAlocation not on record	1
Montpellier, FR	1
QCNElocation not on record	1
Institut de Biologia Evolutiva, (CSIC-UPF)location not on record	1
Calabar, NG	1
FLASlocation not on record	1
Jardín Botánico de Cartagena "Guillermo Piñeres" (JBC)location not on record	1
Jackson, US	1

44 institutions · 628 of 645 vouchered records shown · 17 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Condea verticillata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)