Condea elegans

(Briq.) Harley & J.F.B.Pastore · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Lamiaceae/Condea

At a glance

Occurrence records64

Data sources6

Biological traits13

DNA specimens0

eDNA detections2

Sources6 archives

Databases and archives Condea elegans's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility64 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Occurrence & distributionGBIF64 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingNCBIsequences

01Narrative

Condea elegans is a species of flowering plants in the family Lamiaceae. It is found in South America (Argentina, Brazil, Paraguay). The type specimen is described from Paraguarí, Paraguay.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formperennial

Life spanperennial

Raunkiær life formchamaephyte

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max1 500 m

Elevation min0 m

Epiphyteterrestrial

Growth formherb

Habitat GIFTCerrado (lato sensu), Floresta Estacional Semidecidual

Woodinessnon-woody

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Condea elegans has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

eDNA detections2

The DNA barcodea real sequence read deposited for this species

ITSJF301545.1 ↗751 bp

ACGT

CGCCACCCGCGACGTCGCGAGAAGTCCATTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGG …

Hyptis elegans isolate FS6279 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type64 records

Wild obs. + sensor2

Museum / vouchered62

Origin

Native16

Range

Area of Occupancy AOO128 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 1

2 georeferenced

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 62 records without

Open the institutions mapphysical evidence62

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Saint Louis, US	16
Laboratorio de Ictiologialocation not on record	9
Paleontological Collectionlocation not on record	7
Kew, GB	5
Centro de Estudios y Colecciones Biológicas para la Conservaciónlocation not on record	5
UTFPR-CPlocation not on record	5
Campo Mourão, BR	4
San Jose State University, Museum of Birds and Mammalslocation not on record	3
Boise, US	1
UFBAlocation not on record	1
Moscow State Universitylocation not on record	1
Chicago, US	1
Cascavel, BR	1
Universidade Federal de Santa Catarinalocation not on record	1
Universidad Nacional de Asunciónlocation not on record	1
UFSClocation not on record	1

16 institutions · 62 of 62 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Condea elegans was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)