Condalia velutina — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Rosales/Rhamnaceae/Condalia

At a glance

Occurrence records424

Data sources9

Biological traits2

DNA specimens1

eDNA detections1

Sources9 archives

Databases and archives Condalia velutina's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility424 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF424 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Condalia velutina, known as zarcigüil, zarzagüil or asebuche, is a species of thorny shrub of the Rhamnaceae family endemic to Mexico.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVP

Life cycle & reproduction1

Life formshrub

Habitat & environment1

Climatesubtropical

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Condalia velutina has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSJN900302.1 ↗685 bp

ACGT

AAGGATCATTGTTGAAACCCTGCACAGCAGAACGACCCGTGAACTTGTAAAACACAACCGGGGGGCGAGGGGCCAACCTGAACTCCCTTG …

Condalia velutina isolate CV01 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS1

fungal barcode

08Occurrence & distribution

Record type424 records

Wild obs. + sensor214

Museum / vouchered210

Range

Area of Occupancy AOO888 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 106≤1 km 23≤10 km 10>10 km 1

140 georeferenced · 74 without coordinates

Open the mapobservation + sensor214

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy96% within 1 km

≤100 m 157≤1 km 5≤10 km 5>10 km 2

169 georeferenced · 41 without coordinates

Open the institutions mapphysical evidence210

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Durango, MX	88
Juriquilla, MX	60
Mexico City, MX	13
Saint Louis, US	11
Austin, US	8
Chapingo, MX	7
Mexico City, MX	3
Kew, GB	3
MEXUlocation not on record	3
Austin, US	2
Mexico City, MX	2
Madison, US	2
Tlalnepantla, MX	1
Montecillo, Texcoco, MX	1
Riverside, US	1
Chicago, US	1
Facultad de Ingeniería en Tecnología de la Madera, Universidad Michoacana de San Nicolás de Hidalgolocation not on record	1
South Kensington, GB	1
Chicago, US	1
ASUlocation not on record	1

20 institutions · 210 of 210 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Condalia velutina was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.