Compsopogon caeruleus

(C.Agardh) Mont. · species

image placeholder — illustration coming later

Plantae/Rhodophyta/Compsopogonophyceae/Compsopogonales/Compsopogonaceae/Compsopogon

At a glance

Occurrence records684

Data sources6

Biological traits0

DNA specimens95

eDNA detections98

Sources6 archives

Databases and archives Compsopogon caeruleus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility592 records↗

OBISOcean Biodiversity Information System92 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI98 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics95 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF · OBIS684 records

Environmental DNA2 datasets · 12 countries98 detections

DNA & barcodingBOLD95 specimens

01Narrative

معثنة سماوية هي نوع من النباتات الحمراء تتبع جنس المعثنة من فصيلة المعثنيات.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding95 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Compsopogon caeruleus has left across the world's sequence archives.

At a glance

DNA specimens95

BINs1

Marker genes2

eDNA detections98

Countries13

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P664 bp consensus42 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

277Cmostly conserved

655Gmostly conserved

AATTTTATACTTAATTTTTGGTGCTATATCAGGGTTATTAGGAACTGTTGTTAGTGTAATTATGCGTATGGAATTAACGTACCCTGGGCC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.18%

Haplotypes9

BIN1

Most divergent pair2.0%

N.AmericaS.AmericaAsia

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★rbcL

animal barcodeplant barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_035351 ↗ · 21 protein · 22 tRNA · 2 rRNA

atp6atp8cobnad5nad4nad2nad1nad3nad4Lsdh4sdh3atp9orf180SecYnad6cox1orf155rps3orf414cox3cox2rnsrnl

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type684 records

Wild obs. + sensor61

Museum / vouchered584

Other39

Origin

Native69

Range

Area of Occupancy AOO948 km²

Depth

0–200 m sunlit26

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 5 m · max 115 m · 26 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy73% within 1 km

≤100 m 8≤1 km 25≤10 km 2>10 km 10

45 georeferenced · 16 without coordinates

Open the mapobservation + sensor61

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy68% within 1 km

≤100 m 10≤1 km 115≤10 km 47>10 km 12

184 georeferenced · 400 without coordinates

Open the institutions mapphysical evidence584

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
PHlocation not on record	122
Mount Annan, AU	34
Museo Entomologico de Leonlocation not on record	22
Ann Arbor, US	9
UNESP-IBILCElocation not on record	8
Auckland, NZ	5
BDBClocation not on record	4
Honolulu, US	4
BISHlocation not on record	3
Butler Universitylocation not on record	2
South Kensington, GB	2
New Haven, US	1
USP-IBlocation not on record	1
Brown Universitylocation not on record	1
College Park, US	1
Tampa, US	1
Vancouver, CA	1
Durham, US	1
University of Stellenboschlocation not on record	1
McWane Science Centerlocation not on record	1
Corvallis, US	1

21 institutions · 225 of 584 vouchered records shown · 270 without an institution code

09Environmental DNA98 detections

Where the DNA of Compsopogon caeruleus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found98

Studies independent surveys2

Countries12

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 98 detections have coordinates

Open the map12 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.7 °C 12.5–26.4

Seasonal swing summer↔winter19.1 °C

Max temp (day)27.9 °C 18.4–31.4

Min temp (night)19.5 °C 8.20–23.4

Precipitation79.6 mm/mo 3.10–267

Air humidity57.3 % 48.5–67.6

Moisture balance-38.4 mm/mo -113–157

Vapour deficit1,150 Pa 733–1,488

Wind speed4.10 m/s 1.40–6.20

Cloud cover33.0 % 19.6–45.4

CHELSA 1981–2010, ~9 km grid, at location & month of 68 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)