Commiphora guidottii — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Sapindales/Burseraceae/Commiphora

At a glance

Occurrence records23

Data sources9

Biological traits5

DNA specimens1

eDNA detections1

Sources9 archives

Databases and archives Commiphora guidottii's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility23 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources5 traits

Chemical compositionLOTUS7 compounds

Occurrence & distributionGBIF23 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Commiphora sessiliflora est une espèce d'arbre de la famille des Burseraceae originaire de l'Afrique de l'Est.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Life cycle & reproduction2

Life formshrub or tree

Life spanperennial

Habitat & environment3

Climatedesert or dry shrubland

Growth formshrub

Woodinesswoody

03Chemical composition7 compounds

Compounds documented for Commiphora guidottii across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Bisabolane sesquiterpenoids2

Germacrane sesquiterpenoids2

Cadinane sesquiterpenoids1

Santalane sesquiterpenoids1

Oplopane sesquiterpenoids1

Documented compounds7 total

Compound	Amount	Source
(Z)-alpha-Bisabolene	present	LOTUS
alpha-Bisabolene, (E)-	present	LOTUS
alpha-Santalene	present	LOTUS
Cedrelanol	present	LOTUS
Furanodiene	present	LOTUS
Isofuranodiene	present	LOTUS
Oplopanone	present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Commiphora guidottii has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSJN882679.1 ↗663 bp

ACGT

GCCGAACGACCCGCGAACCCGGTCTGTTCTAGAGAAAACACCCCACCGGGAGGGAGGGGCAGCGCGAGCTCCCCGCCCGGTCCGCAGCCG …

Commiphora guidottii internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS1

fungal barcode

08Occurrence & distribution

Record type23 records

Museum / vouchered23

Range

Area of Occupancy AOO88 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 23 records without

Open the institutions mapphysical evidence23

10Collections & institutions

Holding institutions2 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kew, GB	21
Uppsala, SE	2

2 institutions · 23 of 23 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Commiphora guidottii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.