Commelina erecta
speciesAt a glance
Occurrence records29 205
Data sources13
Biological traits30
DNA specimens34
eDNA detections15
Sources13 archives
Databases and archives Commelina erecta's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility29 205 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics34 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements3 literature sources30 traits
Occurrence & distributionGBIF29 205 records
Environmental DNA1 datasets · 3 countries15 detections
DNA & barcodingBOLD · NCBI34 specimens
Genome at a glanceCCDB · GoaT3.8 Gbp
01Narrative
Commelina erecta, comumente conhecida como trapoeraba, andaca, Santa-Luzia, é uma erva perene nativa das Américas, África e Ásia Ocidental. É considerada a espécie mais variável de Commelina na América do Norte.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTTRY
Size & morphology10
Leaf size705 mm²
Plant height0.7 m
⚠ sources differ — GIFT: 0.7 m · TRY: 0.348 m
Plant height max1.83 m
Plant height min0.01 m
Seed mass11.47 mg
Seed mass max11.47 mg
Seed mass min11.47 mg
Seed volume11 mm³
Seed volume max11 mm³
Seed volume min11 mm³
Life cycle & reproduction4
Deciduousnessdeciduous
Life formperennial or tuberous geophyte
Life spanperennial
Raunkiær life formchamaephyte
Diet & foraging1
Parasiteindependent
Habitat & environment9
Aquaticterrestrial
Climateseasonally dry tropical
Climberself-supporting
Elevation max2 260 m
Elevation min0 m
Epiphyteterrestrial
Growth formherb
Habitat GIFTÁrea Antrópica, Caatinga (stricto sensu), Campo Limpo, Campo Rupestre, Cerrado (lato sensu), Floresta Estacional Decidual, Floresta Estacional Semidecidual, Floresta Ombrófila (= Floresta Pluvial), Restinga, Vegetação Sobre Afloramentos Rochosos
Woodinessnon-woody
Physiology & chemistry6
Leaf C:N ratio36.27 g/g
Leaf c448 mg/g
Leaf n12.36 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Specific leaf area (SLA)30.1 mm²/mg
05DNA & barcoding34 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Commelina erecta has left across the world's sequence archives.
At a glance
DNA specimens34
Marker genes8
GenBank sequences10
eDNA detections15
Countries3
The DNA barcodea real sequence read deposited for this species
ATCATTGTCGAATCCCGAGAACGGACGACCGCGAACCGTCTAACGAACCCGAGCGGTCTCGGGGGGCCGTCGACGGCGGCCCTCCCGCCG …
Commelina erecta isolate 5 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK4★rbcL4★rbcLa★trnL★trnL-F★ITS2★ITS2trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT
The complete instruction manual Commelina erecta carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size3 814 200 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
THIS GENOME Commelina erecta3.81 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 60 n = 30
Ploidy4× tetraploid · measured
Chromosome records52–1202n range60median60mode22records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 6016×GoaT · Kew Plant DNA C-values Database · CCDB · iapt · CCDB · ipcn-api-dl +5
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · iapt — IAPT/IOPB Chromosome Data 9
CCDB · ipcn-api-dl — Cristobal de Hinojo, M. E., L. M. González Villarreal & A. M. Frías de Fernández. 1998. Estudios citogenéticos en el género Commelina L. (Commelinaceae). I. Análisis cariotípico de Commelina erecta L. y Commelina diffusa Burm. Lilloa 39(2): 157–164.
CCDB · ipcn-api-dl — Grabiele, M. 2005. Chromosomes of four species of Commelina (Commelinaceae). Bot. J. Linn. Soc. 148: 207–218.
CCDB · ipcn-api-dl — Pitrez. 2001. Números cromossômicos de espécies de Commelinaceae R. Br. ocorrentes no nordeste do Brasil. Bol. Bot. Univ. São Paulo 19: 7–14.
CCDB · ipcn-api-dl — Umoh, E. O. 1993. Evidence of cytological and morphological evolution in Commelina L. Mem. Soc. Brot. 29: 105–118.
CCDB · ipcn-api-dl — Umoh, E. O., G. M. Hossain & E. E. Ene-Obong. 1991. Cytogenetics of Commelina erecta Linn. from south eastern Nigeria. Cytologia 56: 181–186.
CCDB · book-ipcn72 — JONES, K., & c. JOPLING. 1972. Chromosomes and the classification of the Commelinaceae. Bot. J. Linn. Soc. 65: 129-162.
CCDB · book-ipcn67-71 — SMITH, E.B. 1968. In IOPB chromosome number reports XVII. Taxon 17: 285-288.
CCDB · eflora
CCDB · book-fedorov — Lewis W. H. et al. 1962
CCDB · book-fedorov — Lewis W. H. 1964a
CCDB · book-fedorov — I. 1964)
CCDB · kew — Lewis R, Kenton AY. (pers. comm. 1989).
2n 564×CCDB · book-fedorov · CCDB · Cave1956
CCDB · book-fedorov — Morton J. K. 1956b
CCDB · book-fedorov — I. 1964)
CCDB · Cave1956 — Morton a
CCDB · Cave1956 — Morton a,
2n 521×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database — ↗
2n 1201×CCDB · book-indian_vol2
CCDB · book-indian_vol2 — Malik, C.P. (Rao, R.S. et al. 1970)
n 306×CCDB · ipcn-api-dl · CCDB · Cave1962
CCDB · ipcn-api-dl — Rao, R. S. 1978. Evolutionary trends in some members of Indian Commelinaceae. Proc. Indian Sci. Congr. Assoc. 65: 134–135.
CCDB · ipcn-api-dl — Cristobal, M. E., M. S. Caro Caro, L. M. González Villarreal & A. M. Frias. 2004. Estudios citogenéticos en el género Commelina (Commelinaceae). II Análisis meiótico en Commelina erecta L. y Commelina diffusa Burm. Lilloa 41(1–2): 23–27.
CCDB · ipcn-api-dl — Grabiele, M. 2005. Chromosomes of four species of Commelina (Commelinaceae). Bot. J. Linn. Soc. 148: 207–218.
CCDB · ipcn-api-dl — Ward, D. E. 1984. Chromosome counts from New Mexico and Mexico. Phytologia 56(1): 55–60.
CCDB · ipcn-api-dl — Umoh, E. O., G. M. Hossain & E. E. Ene-Obong. 1991. Cytogenetics of Commelina erecta Linn. from south eastern Nigeria. Cytologia 56: 181–186.
CCDB · Cave1962 — Lewis et al. 1962
n 601×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
tetraploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type29 205 records
Wild obs. + sensor21 774
Museum / vouchered7 293
Other138
Origin
Native1 131
Range
Area of Occupancy AOO61 396 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy88% within 1 km
≤100 m 11 909≤1 km 2 645≤10 km 910>10 km 1 106
16 570 georeferenced · 5 204 without coordinates
Open the mapobservation + sensor21 774
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy75% within 1 km
≤100 m 1 261≤1 km 268≤10 km 400>10 km 107
2 036 georeferenced · 5 257 without coordinates
Open the institutions mapphysical evidence7 293
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions168 of 357 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Durango, MX | 603 |
| Saint Louis, US | 553 |
| Bronx, US | 325 |
| Mexico City, MX | 283 |
| University of Stellenboschlocation not on record | 208 |
| Austin, US | 202 |
| Tampa, US | 151 |
| Laboratorio de Ictiologialocation not on record | 138 |
| Pretoria, ZA | 129 |
| Mérida, MX | 124 |
| Kew, GB | 119 |
| Salvador, BR | 93 |
| Cruz das Almas, BR | 92 |
| UFMSlocation not on record | 86 |
| UNIVASFlocation not on record | 84 |
| Universidade Federal do Rio Grande do Nortelocation not on record | 79 |
| Masindi, UG | 78 |
| Fort Worth, US | 76 |
| National Biodiversity Institute, Costa Ricalocation not on record | 74 |
| Chaguaramas, TT | 74 |
| Feira de Santana, BR | 73 |
| JBRJlocation not on record | 73 |
| Ann Arbor, US | 72 |
| Riverside, US | 72 |
| Chapel Hill, US | 70 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 65 |
| ASUlocation not on record | 61 |
| EL PASO, US | 61 |
| Durban, ZA | 60 |
| Miami, US | 54 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 54 |
| UNICAMPlocation not on record | 53 |
| UFBAlocation not on record | 53 |
| Lubbock, US | 52 |
| Université de Bordeauxlocation not on record | 52 |
| UFPElocation not on record | 48 |
| San Diego, US | 46 |
| Albuquerque, US | 45 |
| Ciudad de México, MX | 45 |
| BAYLUlocation not on record | 44 |
| Bloomington, US | 44 |
| Antiguo Cuscatlán, SV | 44 |
| Universidade Federal de Sergipe (UFS)location not on record | 42 |
| La Paz, MX | 41 |
| Jena Microbial Resource Collectionlocation not on record | 40 |
| Chapingo, MX | 39 |
| Juriquilla, MX | 35 |
| Córdoba, AR | 34 |
| Blumenau, BR | 33 |
| UFESlocation not on record | 32 |
| Bangkok, TH | 31 |
| DOI/NPS, Greenbelt Parklocation not on record | 31 |
| UNESP-FCAlocation not on record | 31 |
| Ciudad de México, MX | 30 |
| CEPLAClocation not on record | 30 |
| Culiacán, MX | 29 |
| Chongqing Museumlocation not on record | 29 |
| Guasave, MX | 29 |
| San Francisco de Campeche, MX | 29 |
| Federal University of Espírito Santolocation not on record | 28 |
| Texas Lutheran Universitylocation not on record | 28 |
| UFRPElocation not on record | 27 |
| Sociedad para el Estudio de los Recursos Bióticos de Oaxaca, A. C.location not on record | 27 |
| MeiseBGlocation not on record | 27 |
| Berlin, DE | 27 |
| Brasília, BR | 26 |
| Valdosta State Universitylocation not on record | 25 |
| Universidade Federal do Vale do São Franciscolocation not on record | 25 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 24 |
| St. Augustine, TT | 23 |
| UTFPR-CPlocation not on record | 23 |
| Tuscaloosa, US | 22 |
| Departamento de Sistematica e Ecologialocation not on record | 22 |
| UnBlocation not on record | 22 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 21 |
| UFMGlocation not on record | 21 |
| León, NI | 21 |
| GB | 20 |
| Tuxtla Gutiérrez, MX | 20 |
| Columbia, US | 19 |
| Tapachula, MX | 19 |
| Universidade Federal do Maranhãolocation not on record | 18 |
| Fayetteville, US | 17 |
| Campo Mourão, BR | 17 |
| Buenos Aires, AR | 17 |
| US | 17 |
| Paleontological Collectionlocation not on record | 17 |
| Fundación Desarrollo y Ambiente FUNDAlocation not on record | 16 |
| UEMlocation not on record | 16 |
| Mexico City, MX | 16 |
| Autlán de Navarro, MX | 16 |
| HACAMlocation not on record | 16 |
| Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record | 16 |
| Zacatecas, MX | 16 |
| Pontifícia Universidade Católica do Paranálocation not on record | 16 |
| Brasília, BR | 15 |
| Phoenix, US | 15 |
| Mississippi State, US | 14 |
| Cenargenlocation not on record | 14 |
| Lincoln, US | 14 |
| Maringá, BR | 14 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 13 |
| Santa Cruz de la Sierra, BO | 13 |
| Pittsburg, US | 13 |
| Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record | 12 |
| UNESP-RClocation not on record | 12 |
| BDBClocation not on record | 12 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 12 |
| HNBlocation not on record | 12 |
| Santa Teresa, BR | 11 |
| AUAlocation not on record | 11 |
| INMAlocation not on record | 11 |
| Denton, US | 11 |
| Universidade Federal do Espírito Santolocation not on record | 10 |
| GAlocation not on record | 10 |
| San José, CR | 10 |
| Giardini Botanici Hanburylocation not on record | 10 |
| CJBGlocation not on record | 10 |
| FUVATESlocation not on record | 10 |
| Ivano-Frankivsk, UA | 10 |
| Museo naturalistico del Frignano Ferruccio Minghellilocation not on record | 10 |
| Hermosillo, MX | 10 |
| Museu Paraense Emílio Goeldilocation not on record | 10 |
| Universidade Federal de Mato Grosso do Sul, Campus do Pantanallocation not on record | 9 |
| Teresina, BR | 9 |
| Tuxtla Gutiérrez, MX | 9 |
| Flagstaff, US | 8 |
| Centro de Estudios y Colecciones Biológicas para la Conservaciónlocation not on record | 8 |
| Clemson, US | 8 |
| Departamento de Geologia, Universidad de Chilelocation not on record | 8 |
| IPA/SPlocation not on record | 8 |
| San Angelo, US | 8 |
| Centre Suisse de Recherches Scientifiques en Côte d’Ivoirelocation not on record | 8 |
| UFSClocation not on record | 8 |
| Xiamen, CN | 8 |
| Claremont, US | 7 |
| MEXUlocation not on record | 7 |
| Foz do Iguaçu, BR | 7 |
| Frankfurt am Main | 7 |
| Toluca, MX | 7 |
| CPATSAlocation not on record | 7 |
| Sucre, BO | 7 |
| Universidade de Passo Fundolocation not on record | 7 |
| Smithsonian Institution, National Museum of Natural History, United States National Herbariumlocation not on record | 7 |
| UFPRlocation not on record | 7 |
| Istituto Agrario Castelnuovolocation not on record | 7 |
| UESBlocation not on record | 7 |
| Universidad Pedagógica y Tecnológica de Colombia (UPTC)location not on record | 6 |
| Paris, FR | 6 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 6 |
| Altos de Pipe, VE | 6 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 6 |
| Bogotá, D.C., CO | 6 |
| UFERSAlocation not on record | 6 |
| Tall Timbers Research Stationlocation not on record | 6 |
| Universidade Federale do Rio Grande do Sullocation not on record | 6 |
| Jackson, US | 6 |
| Institut fur Allgemeine Mikrobiologielocation not on record | 6 |
| Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record | 5 |
| Williamsburg, US | 5 |
| Denver, US | 5 |
| Stockholm, SE | 5 |
| MAlocation not on record | 5 |
| UEMAlocation not on record | 5 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 5 |
| Universidad Nacional de Asunciónlocation not on record | 5 |
| Corrientes, AR | 5 |
| PUC-RSlocation not on record | 5 |
| San Isidro, AR | 5 |
| Universidad del Valle (UV)location not on record | 5 |
| The University of Arizonalocation not on record | 5 |
| Fortaleza, BR | 5 |
| Universidad Nacional de Colombia (UNAL)location not on record | 5 |
| Jardín Botánico de Cartagena "Guillermo Piñeres" (JBC)location not on record | 5 |
| Museum of Zoologylocation not on record | 5 |
| Boise, US | 5 |
| NO DISPONIBLElocation not on record | 5 |
| China Agricultural Universitylocation not on record | 4 |
| Henderson State Universitylocation not on record | 4 |
| Norfolk, US | 4 |
| Cambridge, US | 4 |
| Aarhus, DK | 4 |
| LSF/FSA/UAClocation not on record | 4 |
| Stephenville, US | 4 |
| La Paz, BO | 4 |
| University of Southern Mississippilocation not on record | 4 |
| Wuzhou, CN | 4 |
| LNBG$location not on record | 4 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 4 |
| UFRRJlocation not on record | 4 |
| Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record | 4 |
| UNEMATlocation not on record | 4 |
| Castelar, AR | 4 |
| Davenport, US | 4 |
| URCAlocation not on record | 4 |
| HUENFlocation not on record | 3 |
| Zapopan, MX | 3 |
| Provo, US | 3 |
| Universidade Federal de Santa Catarinalocation not on record | 3 |
| Canadian Department of Agriculturelocation not on record | 3 |
| Jataí / Setor Industrial, BR | 3 |
| Cochabamba, BO | 3 |
| McWane Science Centerlocation not on record | 3 |
| UNESP-IBILCElocation not on record | 3 |
| Montréal, CA | 3 |
| ESALQlocation not on record | 3 |
| Mazatlán, MX | 3 |
| INTAlocation not on record | 3 |
| Ural Federal University "B. N. Yeltsin"location not on record | 3 |
| Burlington, US | 3 |
| Little Rock, US | 3 |
| Seropédica, BR | 3 |
| Ensenada, MX | 3 |
| Fairfax, US | 3 |
| Area de Conservacion Guanacastelocation not on record | 3 |
| Pontifícia Universidade Católica do Paranálocation not on record | 3 |
| South Kensington, GB | 3 |
| Moscow State Universitylocation not on record | 3 |
| San Luis Potosí, MX | 3 |
| Arizona State University Biocollectionslocation not on record | 3 |
| Corporación Autónoma Regional Para la Defensa de la Meseta de Bucaramanga (CDMB)location not on record | 2 |
| Campo Grande, BR | 2 |
| Ciudad Juárez, MX | 2 |
| Tempe, US | 2 |
| UFOPlocation not on record | 2 |
| Odawara, JP | 2 |
| Guatemala City, GT | 2 |
| Knoxville, US | 2 |
| UEPAlocation not on record | 2 |
| Davis, US | 2 |
| Mexico City, MX | 2 |
| Uberlândia, BR | 2 |
| Universidade Federal de Goiáslocation not on record | 2 |
| San Francisco, US | 2 |
| Philadelphia, US | 2 |
| FPMZBlocation not on record | 2 |
| CASlocation not on record | 2 |
| UNESP-FCAVlocation not on record | 2 |
| UDESC-CAVlocation not on record | 2 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 2 |
| Morelia, MX | 2 |
| BClocation not on record | 2 |
| Santa Maria, BR | 2 |
| Pullman, US | 2 |
| Mérida, MX | 2 |
| Universidad Industrial de Santander (UIS)location not on record | 2 |
| LDlocation not on record | 2 |
| HUAlocation not on record | 2 |
| Herbario Selva Central Oxapampa - estación biológica del Jardín Botánico de Missourilocation not on record | 2 |
| Elikins, US | 2 |
| Durham, US | 2 |
| International Salmonella Centre (W.H.O.)location not on record | 2 |
| Cascavel, BR | 2 |
| Universiti Sains Malaysialocation not on record | 2 |
| Pelotas, BR | 2 |
| Maryland Department of Natural Resourceslocation not on record | 2 |
| TAIElocation not on record | 2 |
| Glocation not on record | 2 |
| Millersville, US | 2 |
| OTSlocation not on record | 2 |
| Chicago, US | 2 |
| Criciúma, BR | 1 |
| Santa Barbara, US | 1 |
| Texas Lutheran Universitylocation not on record | 1 |
| Minia, EG | 1 |
| Göteborg, SE | 1 |
| Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record | 1 |
| NGCPR01229location not on record | 1 |
| USP-IBlocation not on record | 1 |
| Centre National de la Recherche Appliquée au Developement Rurallocation not on record | 1 |
| Florida Museum of Natural Historylocation not on record | 1 |
| LSFlocation not on record | 1 |
| University of Iowalocation not on record | 1 |
| BIO-UNIPIlocation not on record | 1 |
| HEMlocation not on record | 1 |
| Facultad de Zootecnia y Ecología, Universidad Autónoma de Chihuahualocation not on record | 1 |
| NGCPR01244location not on record | 1 |
| NGCPR01238location not on record | 1 |
| Montpellier, FR | 1 |
| Instituto de Ecología Aplicada, Universidad Autónoma de Tamaulipaslocation not on record | 1 |
| NGCPR01234location not on record | 1 |
| BMlocation not on record | 1 |
| NGCPR01240location not on record | 1 |
| NGCPR01231location not on record | 1 |
| New Haven, US | 1 |
| FLASlocation not on record | 1 |
| NGCPR01235location not on record | 1 |
| IECOSlocation not on record | 1 |
| Puerto Ayora, EC | 1 |
| Long Beach, US | 1 |
| QCNElocation not on record | 1 |
| UFAClocation not on record | 1 |
| DOI/NPS, Selma to Montgomery National Historic Traillocation not on record | 1 |
| Quito, EC | 1 |
| NGCPR01242location not on record | 1 |
| Universidad Autónoma de Occidentelocation not on record | 1 |
| Universidad de Pamplona (UPamplona)location not on record | 1 |
| Audubon Society -- Silver Bluff Audubon Center and Sanctuarylocation not on record | 1 |
| Los Angeles, US | 1 |
| Universidad de Valparaísolocation not on record | 1 |
| Ilhéus, BR | 1 |
| UFSCarlocation not on record | 1 |
| FUNEDlocation not on record | 1 |
| Arusha, TZ | 1 |
| Mexico City, MX | 1 |
| Colgate Universitylocation not on record | 1 |
| UNITINSlocation not on record | 1 |
| Pondicherry, IN | 1 |
| Spearfish, US | 1 |
| College Park, US | 1 |
| UFVJMlocation not on record | 1 |
| NGCPR01237location not on record | 1 |
| NGCPR01233location not on record | 1 |
| NGCPR01230location not on record | 1 |
| NGCPR01232location not on record | 1 |
| NGCPR01236location not on record | 1 |
| NGCPR01241location not on record | 1 |
| NGCPR01243location not on record | 1 |
| UTFPR-SLlocation not on record | 1 |
| UFABClocation not on record | 1 |
| Managua, NI | 1 |
| Taipei, TW | 1 |
| UNIVILLElocation not on record | 1 |
| Madison, US | 1 |
| Anchorage, US | 1 |
| Dekalb, US | 1 |
| Tlalnepantla, MX | 1 |
| Felix d'Herelle Reference Center for Bacterial Viruseslocation not on record | 1 |
| UTFPR-DVlocation not on record | 1 |
| Puebla, MX | 1 |
| US | 1 |
| Angwin, US | 1 |
| Centro de Investigaciones Biológicas, Universidad Autónoma del Estado de Hidalgolocation not on record | 1 |
| Western Carolina Universitylocation not on record | 1 |
| Linares, MX | 1 |
| University of Tennessee at Chattanoogalocation not on record | 1 |
| US | 1 |
| Guatemala, GT | 1 |
| Fredericksburg, US | 1 |
| Adam Mickiewicz University in Poznańlocation not on record | 1 |
| Salamanca, ES | 1 |
| Ciudad de México, MX | 1 |
| UERJlocation not on record | 1 |
| Universidade da Região de Joinville - Univillelocation not on record | 1 |
| Instituto do Meio Ambientelocation not on record | 1 |
| Morgantown, US | 1 |
| Santarém, BR | 1 |
| Cuiabá, BR | 1 |
| Edmonton, CA | 1 |
| Wlocation not on record | 1 |
| National Museums of Kenyalocation not on record | 1 |
| Universidade de São Paulolocation not on record | 1 |
| REALlocation not on record | 1 |
| Durham, US | 1 |
| Durango, US | 1 |
| Springfield, US | 1 |
| Fargo, US | 1 |
357 institutions · 7 123 of 7 293 vouchered records shown · 169 without an institution code
09Environmental DNA15 detections
Where the DNA of Commelina erecta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found15
Studies independent surveys1
Countries3
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 15 detections have coordinates
Open the map3 countries0
Shaded areared soil,growing near grewia,commelina ,brev…Found at UHURU South Plots.; Savanna bushlan…
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median19.9 °C 19.2–26.4
Seasonal swing summer↔winter2.60 °C
Max temp (day)25.1 °C 24.9–30.0
Min temp (night)14.5 °C 13.0–22.7
Precipitation94.5 mm/mo 31.8–110
Air humidity57.7 % 53.8–62.2
Moisture balance-54.5 mm/mo -111–-28.7
Vapour deficit1,006 Pa 816–1,275
Wind speed2.70 m/s 2.60–3.80
Cloud cover35.3 % 29.8–43.4
CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.