Commelina ensifolia

R.Br. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Commelinales/Commelinaceae/Commelina

At a glance

Occurrence records2 849

Data sources8

Biological traits36

DNA specimens2

eDNA detections2

Sources8 archives

Databases and archives Commelina ensifolia's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 849 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources36 traits

Occurrence & distributionGBIF2 849 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 90

01Narrative

وعلان سيفي الأوراق هو نوع من النباتات يتبع جنس الوعلان من الفصيلة الوعلانية.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology13

Fruit length6 mm

Leaf length50 mm

Leaf length max120 mm

Leaf length min50 mm

Leaf size1 440 mm²

Leaf width7.5 mm

Leaf width max12 mm

Leaf width min5 mm

Plant height0.4 m

Plant height max0.5 m

Plant height min0 m

Seed length3.5 mm

Seed mass14.84 mg

Life cycle & reproduction9

Dehiscencedehiscent

Dispersal typeanimal

Flowering timeyyyyynnnyyyy

Life formperennial or rhizomatous geophyte

Life spanperennial

⚠ sources differ — AusTraits: perennial · GIFT: annual

Pollination syndromeinsect

Raunkiær life formtherophyte

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

Leaf compoundnesssimple

Leaf shapelanceolate linear ovate

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Commelina ensifolia has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences3

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKF496644.1 ↗566 bpAustralia · 2013

ACGT

CTAAAGCAAGTGTTGGATTTAAAGCGGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGAGTACATAACCAAGGATACTGATATAT …

Commelina ensifolia isolate KH05 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Commelina ensifolia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 90 n = 45

Ploidypolyploid inferred

Chromosome records90–902n range90median90mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 905×CCDB · book-indian_vol2 · CCDB · book-fedorov

CCDB · book-indian_vol2 — Kammathy, R.V. & Rao, S.R. 1961a, 1965

CCDB · book-fedorov — Kammathy, Rao 1961a

CCDB · book-fedorov — I. 1961)

CCDB · book-fedorov — Kammathy, Rao

CCDB · book-fedorov — C. n. V. 1965)

n 451×CCDB · book-ipcn65

CCDB · book-ipcn65 — Kammathy & R. 1964

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type2 849 records

Wild obs. + sensor1 478

Museum / vouchered1 198

Other173

Origin

Native102

Introduced1

Range

Area of Occupancy AOO8 096 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 614≤1 km 29≤10 km 23>10 km 9

675 georeferenced · 803 without coordinates

Open the mapobservation + sensor1 478

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy36% within 1 km

≤100 m 325≤1 km 51≤10 km 561>10 km 101

1 038 georeferenced · 160 without coordinates

Open the institutions mapphysical evidence1 198

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 28 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	358
Palmerston, AU	308
Kensington, AU	133
Museo Entomologico de Leonlocation not on record	117
Canberra, AU	77
Smithfield, AU	63
Mount Annan, AU	48
Adelaide, AU	38
Kew, GB	9
James Cook Townsvillelocation not on record	9
BGPAlocation not on record	4
Honolulu, US	4
NSW Dept of Planning, Industry and Environmentlocation not on record	3
Armidale, AU	3
Hobart, AU	2
John T. Waterhouse Herbariumlocation not on record	2
University of Stellenboschlocation not on record	2
NGCPR00059location not on record	1
NGCPR00051location not on record	1
NGCPR01246location not on record	1
NGCPR00060location not on record	1
NGCPR01221location not on record	1
LDlocation not on record	1
Pondicherry, IN	1
NGCPR00061location not on record	1
NGCPR01222location not on record	1
Claremont, US	1
Australian Tropical Herbariumlocation not on record	1

28 institutions · 1 191 of 1 198 vouchered records shown · 6 without an institution code

09Environmental DNA2 detections

Where the DNA of Commelina ensifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.9 °C 22.3–25.5

Seasonal swing summer↔winter12.8 °C

Max temp (day)29.5 °C 28.7–30.3

Min temp (night)18.1 °C 15.6–20.6

Precipitation130 mm/mo 38.4–221

Air humidity51.5 % 45.0–58.0

Moisture balance-44.3 mm/mo -123–34.3

Vapour deficit1,489 Pa 1,381–1,597

Wind speed3.80 m/s 3.60–3.90

Cloud cover37.8 % 22.0–53.5

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Commelina ensifolia

At a glance

Sources8 archives

Size & morphology13

Life cycle & reproduction9

Diet & foraging1

Habitat & environment10

Physiology & chemistry2

Other traits1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type2 849 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions13 of 28 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 849 records