Commelina cyanea

R.Br. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Commelinales/Commelinaceae/Commelina

At a glance

Occurrence records13 686

Data sources8

Biological traits36

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Commelina cyanea's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility13 686 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources36 traits

Occurrence & distributionGBIF13 686 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 42

01Narrative

Commelina cyanea, commonly known as scurvy weed, is a perennial prostrate herb of the family Commelinaceae native to moist forests and woodlands of eastern Australia,PlantNET, plant profile Commelina cyanea Lord Howe Island and Norfolk Island. The blue flowers appear over the warmer months and are pollinated by bees and flies.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology11

Leaf length50 mm

Leaf length max70 mm

Leaf length min20 mm

Leaf width10 mm

Leaf width max15 mm

Leaf width min5 mm

Plant height0.1 m

Plant height max0.5 m

Plant height min0 m

Seed length2.5 mm

Seed mass17.5 mg

Life cycle & reproduction11

Deciduousnessevergreen

Dehiscencedehiscent

Dispersal typeself

Flowering timeyyyyynnnyyyy

Life spanperennial

Lifespan years13.5 years

Pollination syndromeinsect

Raunkiær life formtherophyte

Reproductive maturity1 years

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment11

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

⚠ sources differ — GIFT: herb · AusTraits: herb · TRY: herb/non-woody

Habitat GIFTdense secondary shrub and ruderal vegetation

Leaf compoundnesssimple

Leaf shapenarrowly_ovate ovate

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Commelina cyanea has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLOR165422.1 ↗1 437 bpAustralia · 2019

ACGT

ATGTCACCACAAACAGAGACTAAAGCAAGTGTTGGATTTAAAGCGGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGAGTACATA …

Commelina cyanea voucher JH190221001 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Commelina cyanea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 42 n = 21

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 421×CCDB · book-ipcn72

CCDB · book-ipcn72 — JONES, K., & c. JOPLING. 1972. Chromosomes and the classification of the Commelinaceae. Bot. J. Linn. Soc. 65: 129-162.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type13 686 records

Wild obs. + sensor13 081

Museum / vouchered605

Origin

Native146

Range

Area of Occupancy AOO23 544 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 10 693≤1 km 1 330≤10 km 223>10 km 187

12 433 georeferenced · 648 without coordinates

Open the mapobservation + sensor13 081

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy51% within 1 km

≤100 m 210≤1 km 61≤10 km 217>10 km 44

532 georeferenced · 73 without coordinates

Open the institutions mapphysical evidence605

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	263
Mount Annan, AU	142
Canberra, AU	66
Armidale, AU	59
NSW Dept of Planning, Industry and Environmentlocation not on record	13
John T. Waterhouse Herbariumlocation not on record	10
Adelaide, AU	7
Kew, GB	6
Wollongong, AU	5
Batemans Bay, AU	5
Auckland, NZ	4
Hobart, AU	2
University of Stellenboschlocation not on record	2
Honolulu, US	2
Palmerston, AU	2
IPA/SPlocation not on record	1
NSW Office of Environment and Heritagelocation not on record	1
Museo Entomologico de Leonlocation not on record	1
James Cook Townsvillelocation not on record	1
Wellington, NZ	1
MeiseBGlocation not on record	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
Canadian Department of Agriculturelocation not on record	1

23 institutions · 596 of 605 vouchered records shown · 9 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Commelina cyanea

At a glance

Sources8 archives

Size & morphology11

Life cycle & reproduction11

Diet & foraging1

Habitat & environment11

Physiology & chemistry2

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type13 686 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions13 of 23 geolocated

Record type13 686 records