Commelina ciliata

Stanley · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Commelinales/Commelinaceae/Commelina

At a glance

Occurrence records224

Data sources5

Biological traits14

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Commelina ciliata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility224 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources14 traits

Occurrence & distributionGBIF224 records

DNA & barcodingNCBIsequences

01Narrative

Commelina ciliata is found in the Northern Territories and in Western Australia. It is an annual or perennial herb with a prostrate or semi-prostrate habit that can reach 0.7 m in height. It is found in water-retaining soils and areas such as creeks and floodplains. It flowers in the rainy season between March and August and has blue flowers. The species was first described in 1917 as C. acuminata and since a holotype was not designated at the time, the specimen used for the description has been assigned as the lectotype.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFT

Size & morphology2

Plant height0.7 m

Plant height max0.7 m

Life cycle & reproduction4

Flowering timennyyyyyynnnn

Life spanannual perennial

⚠ sources differ — AusTraits: annual perennial · GIFT: annual

Raunkiær life formtherophyte

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

Woodinessnon-woody

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Commelina ciliata has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLOR165420.1 ↗1 437 bpAustralia · 2017

ACGT

ATGTCACCACAAACAGAGACTAAAGCAAGTGTTGGATTTAAAGCGGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGAGTACATA …

Commelina ciliata voucher 705 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1

plant barcode

08Occurrence & distribution

Record type224 records

Wild obs. + sensor88

Museum / vouchered136

Origin

Native21

Range

Area of Occupancy AOO640 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 37

37 georeferenced · 51 without coordinates

Open the mapobservation + sensor88

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 46≤1 km 7≤10 km 47>10 km 6

106 georeferenced · 30 without coordinates

Open the institutions mapphysical evidence136

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Palmerston, AU	51
Kensington, AU	25
Brisbane, AU	15
Museo Entomologico de Leonlocation not on record	11
Canberra, AU	11
James Cook Townsvillelocation not on record	6
Smithfield, AU	6
Mount Annan, AU	5
Adelaide, AU	3
STUlocation not on record	1

10 institutions · 134 of 136 vouchered records shown · 2 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)