Commelina africana

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Commelinales/Commelinaceae/Commelina

At a glance

Occurrence records2 745

Data sources13

Biological traits33

DNA specimens20

eDNA detections10

Sources13 archives

Databases and archives Commelina africana's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 745 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics20 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Paleobiology DatabasePBDB consortiumfossil record↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources33 traits

Occurrence & distributionGBIF2 745 records

Environmental DNA1 datasets · 3 countries10 detections

DNA & barcodingBOLD · NCBI20 specimens

Genome at a glanceCCDB · GoaT3.6 Gbp

01Narrative

وعلان أفريقي هو نوع من النباتات يتبع جنس الوعلان من الفصيلة الوعلانية.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology11

Leaf length37.5 mm

Leaf length max50 mm

Leaf length min25 mm

Leaf width12.5 mm

Leaf width max15 mm

Leaf width min10 mm

Plant height0.5 m

Plant height max0.914 m

Plant height min0.05 m

Seed length3.5 mm

Seed mass3.38 mg

Life cycle & reproduction8

Dispersal typeself

Flowering timeyyyyynnnyyyy

Life formperennial or subshrub

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formchamaephyte

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment11

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Elevation max2 160 m

Elevation min2 m

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

Leaf compoundnesssimple

Woodinessnon-woody

⚠ sources differ — TRY: H · AusTraits: herbaceous woody_root · GIFT: non-woody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

Other traits1

Plant support typefree-standing

05DNA & barcoding20 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Commelina africana has left across the world's sequence archives.

At a glance

DNA specimens20

Marker genes6

GenBank sequences10

eDNA detections10

Countries3

The DNA barcodea real sequence read deposited for this species

ITSKR734185.1 ↗248 bpKenya · 2014

ACGT

GATCATTGTCGAATCCCGAGAACGGACGACCGCGAACCGTAAAACCAACCCTCGCGGCCGGACGGGTCCGCCCGTCCGCCGCGCAAAAAA …

Commelina africana internal transcribed spacer 1 and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL6★rbcLa★trnL-F★ITS2trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB · GoaT

The complete instruction manual Commelina africana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size3 618 600 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Commelina africana3.62 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 30 n = 15

Ploidy2× diploid · measured

Chromosome records28–902n range30median30mode14records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 308×GoaT · Kew Plant DNA C-values Database · CCDB · ipcn-api-dl · CCDB · book-ipcn72 +3

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · ipcn-api-dl

CCDB · book-ipcn72 — JONES, K., & c. JOPLING. 1972. Chromosomes and the classification of the Commelinaceae. Bot. J. Linn. Soc. 65: 129-162.

CCDB · book-ipcn67-71 — HARVEY, M.J. 1967. In IOPB chromosome number reports IX. Taxon 16: 62-66.

CCDB · book-fedorov — Harvey (C. n. VII. 1966)

CCDB · kew — Lewis R, Kenton AY. (pers. comm. 1989).

2n 284×CCDB · ipcn-api-dl · CCDB · book-fedorov · CCDB · Cave1956

CCDB · ipcn-api-dl

CCDB · book-fedorov — Morton J. K. 1956b

CCDB · Cave1956 — Morton a

2n 191×CCDB · book-fedorov

CCDB · book-fedorov — G4)

2n 601×CCDB · kew

CCDB · kew — Lewis R, Kenton AY. (pers. comm. 1989).

2n 901×CCDB · kew

CCDB · kew — Lewis R, Kenton AY. (pers. comm. 1989).

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type2 745 records

Wild obs. + sensor2 288

Museum / vouchered362

Cultivated / captive1

Other94

Origin

Native1

Introduced8

Range

Area of Occupancy AOO6 604 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 1 330≤1 km 259≤10 km 109>10 km 32

1 730 georeferenced · 558 without coordinates

Open the mapobservation + sensor2 288

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy75% within 1 km

≤100 m 5≤1 km 7≤10 km 4

16 georeferenced · 346 without coordinates

Open the institutions mapphysical evidence362

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 47 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
MeiseBGlocation not on record	73
Adam Mickiewicz University in Poznańlocation not on record	46
Kew, GB	46
Saint Louis, US	25
University of Stellenboschlocation not on record	15
LDlocation not on record	6
Leiden University Medical Centerlocation not on record	5
Mount Annan, AU	4
Plocation not on record	4
Smithsonian Institution, National Museum of Natural History, United States National Herbariumlocation not on record	4
Forest Herbarium Ibadan (FHI)location not on record	3
Uppsala, SE	3
Institut de Recherche Agronomique de Guinée (IRAG)location not on record	3
Dresden, DE	3
Bronx, US	3
Felix d'Herelle Reference Center for Bacterial Viruseslocation not on record	3
Herbier National du Gabonlocation not on record	2
South African National Biodiversity Institute, Compton Herbariumlocation not on record	2
Millersville, US	2
Yaoundé, CM	2
University of Johannesburglocation not on record	2
TAFORI-LSRClocation not on record	2
BRLUlocation not on record	2
WAGlocation not on record	2
Jackson, US	2
CJBGlocation not on record	1
Moscow State Universitylocation not on record	1
Buenos Aires, AR	1
Museo Entomologico de Leonlocation not on record	1
National Institute of Hygienic Scienceslocation not on record	1
Cape Town, ZA	1
Chiba, JP	1
LBVlocation not on record	1
Glocation not on record	1
Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record	1
CNF-UFHBlocation not on record	1
UC_PESHlocation not on record	1
Wlocation not on record	1
CRSN_LWIROlocation not on record	1
Institut de Recherche Agronomique de Guinée (IRAG)location not on record	1
MAlocation not on record	1
EFGlocation not on record	1
Coimbra, PT	1
Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record	1
Stockholm, SE	1
Edinburgh, GB	1
South Kensington, GB	1

47 institutions · 286 of 362 vouchered records shown · 76 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA10 detections

Where the DNA of Commelina africana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map3 countries0

red soil,growing near,cynodon plectostachyus…Hill slope;Variable;Disturbed;Dolerite;Clay

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.5 °C 19.1–25.5

Seasonal swing summer↔winter4.60 °C

Max temp (day)25.4 °C 24.5–30.1

Min temp (night)13.8 °C 13.0–20.4

Precipitation59.7 mm/mo 31.8–112

Air humidity53.8 % 52.7–60.3

Moisture balance-89.4 mm/mo -111–-50.7

Vapour deficit1,046 Pa 1,011–1,357

Wind speed2.70 m/s 2.60–3.40

Cloud cover33.9 % 24.0–44.5

CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Commelina africana

At a glance

Sources13 archives

Size & morphology11

Life cycle & reproduction8

Diet & foraging1

Habitat & environment11

Physiology & chemistry1

Other traits1

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type2 745 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions16 of 47 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 745 records