Combretum micranthum

G.Don · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Combretaceae/Combretum

At a glance

Occurrence records2 182

Data sources14

Biological traits22

DNA specimens5

eDNA detections4

Sources14 archives

Databases and archives Combretum micranthum's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 182 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources22 traits

Chemical compositionLOTUS11 compounds

Occurrence & distributionGBIF2 182 records

Environmental DNA1 datasets · 0 countries4 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceCCDB · GoaT · NCBI≈1.9 Gbp

01Narrative

Combretum micranthum is a species of flowering plant in the family Combretaceae. It is a shrub known as kinkeliba in Benin, Burkina Faso, Senegal, Mali and the Gambia across multiple regional dialects, where it is often found in tiger bush and on hills in West Africa. It is used for making tea and has uses in traditional medicine, and is used by many West African Muslims during Ramadan to break their fast. The name kinkeliba is believed to come from the Fulani language. It is referred to as sekhew in the Wolof language and ŋɔlɔbɛ in the Bambara language.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology5

Leaf size1 321 mm²

Plant height4 m

Seed mass27.04 mg

Seed mass max36.51 mg

Seed mass min11.74 mg

Life cycle & reproduction4

Deciduousnessvariable

Life formscrambling shrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

⚠ sources differ — GIFT: shrub · TRY: Top.Canopy.Tree

Woodinesswoody

Physiology & chemistry6

Leaf c478 mg/g

Leaf n25.93 mg/g

Leaf p1.52 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)13.84 mm²/mg

03Chemical composition11 compounds

Compounds documented for Combretum micranthum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Flavones4

Flavonols2

Gallotannins $ Simple phenolic acids1

Pyrrolidine alkaloids1

Cyclitols1

Documented compounds11 total

Tissue Source Quantified only

Compound	Amount	Source
1D-chiro-inositol	present	LOTUS
Betaine	present	LOTUS
Choline	present	LOTUS
Gallic acid	present	LOTUS
Isoorientin 7-O-(6'''-O-(E)-feruloyl)glucoside	present	LOTUS
Isovitexin	present	LOTUS
L-Stachydrine	present	LOTUS
Myricetin 3-glucoside	present	LOTUS
Myricetin 3-rutinoside	present	LOTUS
Orientin	present	LOTUS

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Combretum micranthum has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes5

GenBank sequences4

eDNA detections4

Countries2

The DNA barcodea real sequence read deposited for this species

ITSFJ381759.1 ↗847 bp

ACGT

CGGTGAAGTGTTCGGATCGCGGCGACGTGGGCGGTTCGCCGCCGACGACGTCGCGAGAAGTCCACTGAACCTTATCATTTAGAGGAAGGA …

Combretum micranthum 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2★rbcLa★ITS1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT · NCBI

The complete instruction manual Combretum micranthum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈1 865 111 820 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Combretum micranthum1.87 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 26 n = 13

Ploidydiploid inferred

Chromosome records26–262n range26median26mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 262×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78

CCDB · ipcn-api-dl — Brighton, C. A. & G. E. WICKENS. 1976. Some chromosome counts in the genus Combretum (Combretaceae) . Kew Bull. 31: 5–8.

CCDB · book-ipcn75-78 — Brighton

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelContig

08Occurrence & distribution

Record type2 182 records

Wild obs. + sensor1 650

Museum / vouchered482

Cultivated / captive6

Other44

Range

Area of Occupancy AOO5 304 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 28≤1 km 4≤10 km 1>10 km 3

36 georeferenced · 1 614 without coordinates

Open the mapobservation + sensor1 650

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 16

16 georeferenced · 466 without coordinates

Open the institutions mapphysical evidence482

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 6 records without

Open the mapnot free-living6

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 35 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paris, FR	60
Centre National de la Recherche Scientifique et Technologique / Institut de l'environnement et de recherches agricoleslocation not on record	50
Frankfurt am Main	46
Saint Louis, US	43
Kew, GB	28
HNBlocation not on record	28
Adam Mickiewicz University in Poznańlocation not on record	25
WAGlocation not on record	17
LSF/FSA/UAClocation not on record	11
Herbier National du Gabonlocation not on record	10
Plocation not on record	10
Université du Lomélocation not on record	8
Institut de Recherche Agronomique de Guinée (IRAG)location not on record	8
Xiamen, CN	8
Monastir, TN	7
Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record	7
MAlocation not on record	5
Glocation not on record	4
Moscow State Universitylocation not on record	3
Stockholm, SE	2
Centre National de Semences Forestièreslocation not on record	2
CNF-UFHBlocation not on record	2
Elocation not on record	2
MeiseBGlocation not on record	2
Beijing, CN	2
Claremont, US	1
Université National du Béninlocation not on record	1
Bronx, US	1
Senckenberg Gesellschaft für Naturforschung: Senckenberg Forschungsinstitut und Naturmuseumlocation not on record	1
Mlocation not on record	1
University of Stellenboschlocation not on record	1
National Natural History Collectionslocation not on record	1
Berlin, DE	1
Llocation not on record	1
Centre Suisse de Recherches Scientifiques en Côte d’Ivoirelocation not on record	1

35 institutions · 400 of 482 vouchered records shown · 82 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA4 detections

Where the DNA of Combretum micranthum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Combretum micranthum

At a glance

Sources14 archives

Size & morphology5

Life cycle & reproduction4

Diet & foraging1

Habitat & environment6

Physiology & chemistry6

Compound class profile5 classes

Documented compounds11 total

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Sequencing statusassembly quality — how far to trust these numbers

Record type2 182 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions11 of 35 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type2 182 records