Combretum fruticosum
(Loefl.) Stuntz · speciesAt a glance
Occurrence records3 106
Data sources8
Biological traits22
DNA specimens0
eDNA detections0
Sources8 archives
Databases and archives Combretum fruticosum's data was compiled from.
WikipediaWikimedia Foundation4 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility3 106 records↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page5 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements3 literature sources22 traits
Chemical compositionLOTUS11 compounds
Occurrence & distributionGBIF3 106 records
DNA & barcodingNCBIsequences
01Narrative
Combretum fruticosum, known as orange flame vine or chameleon vine, is a species of bushwillow that occurs from Mexico to northern Argentina. View of the plant
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTTRY
Size & morphology2
Leaf size9 500 mm²
Seed mass80.4 mg
Life cycle & reproduction4
Deciduousnessevergreen
Life formscrambling shrub or tree
Life spanperennial
Raunkiær life formphanerophyte
Diet & foraging1
Parasiteindependent
Habitat & environment9
Aquaticterrestrial
Climateseasonally dry tropical
Climberobligatory
Elevation max1 130 m
Elevation min0 m
Epiphyteterrestrial
Growth formshrub
⚠ sources differ — GIFT: shrub · TRY: Vine
Habitat GIFTCaatinga (stricto sensu), Floresta Ombrófila (= Floresta Pluvial)
Woodinesswoody
Physiology & chemistry6
Leaf n26.55 mg/g
Leaf p1.11 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Specific leaf area (SLA)12.44 mm²/mg
Wood density587 mg/cm³
03Chemical composition11 compounds
Compounds documented for Combretum fruticosum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile3 classes
Oleanane triterpenoids6
Ursane and Taraxastane triterpenoids3
Lupane triterpenoids2
Documented compounds11 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (1R,3aS,5aR,5bR,7aR,9S,11aR,11bR,13aR,13bS)-9-hydroxy-5a,5b,8,8,11a-pentamethyl-1-prop-1-en-2-yl-1,2,3,4,5,6,7,7a,9,10,11,11b,12,13,13a,13b-hexadecahydrocyclopenta[a]chrysene-3a-carboxylic acid | present | LOTUS | |
| [(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl] (1R,3aS,5aR,5bR,7R,7aR,9R,10R,11aR,11bR,13aR,13bS)-7,9,10-trihydroxy-5a,5b,8,8,11a-pentamethyl-1-prop-1-en-2-yl-1,2,3,4,5,6,7,7a,9,10,11,11b,12,13,13a,13b-hexadecahydrocyclopenta[a]chrysene-3a-carboxylate | present | LOTUS | |
| [(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl] (1S,2R,4aS,6aR,6aS,6bR,8aR,10R,11R,12aR,14bS)-10,11-dihydroxy-9,9-bis(hydroxymethyl)-1,2,6a,6b,12a-pentamethyl-2,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydro-1H-picene-4a-carboxylate | present | LOTUS | |
| [(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl] (4aS,6aR,6aS,6bR,8aR,9S,10R,11R,12aR,14bS)-10,11-dihydroxy-9-(hydroxymethyl)-2,2,6a,6b,9,12a-hexamethyl-1,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydropicene-4a-carboxylate | present | LOTUS | |
| [(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl] (4aS,6aR,6aS,6bR,8R,8aR,10R,11R,12aR,14bS)-8,10,11-trihydroxy-2,2,6a,6b,9,9,12a-heptamethyl-1,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydropicene-4a-carboxylate | present | LOTUS | |
| Arjunglucoside II | present | LOTUS | |
| Arjunolic Acid | present | LOTUS | |
| Asiatic Acid | present | LOTUS | |
| Bellericoside | present | LOTUS | |
| chebuloside II | present | LOTUS |
05DNA & barcoding10 sequences
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Combretum fruticosum has left across the world's sequence archives.
At a glance
Marker genes3
GenBank sequences10
Countries3
The DNA barcodea real sequence read deposited for this species
AACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTTGGCTAAGGGCACGCCTGCCTGGGTGTCACGCATCGCGTTGCCTCCAAAAC …
Combretum fruticosum voucher IBUG:197628 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK1★rbcL8★ITS1
plant barcodefungal barcode
08Occurrence & distribution
Record type3 106 records
Wild obs. + sensor462
Museum / vouchered2 641
Cultivated / captive1
Other2
Origin
Native309
Range
Area of Occupancy AOO6 564 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy83% within 1 km
≤100 m 98≤1 km 55≤10 km 24>10 km 8
185 georeferenced · 277 without coordinates
Open the mapobservation + sensor462
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy90% within 1 km
≤100 m 504≤1 km 26≤10 km 42>10 km 14
586 georeferenced · 2 055 without coordinates
Open the institutions mapphysical evidence2 641
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy
no georeferenced coordinates · 1 records without
Open the mapnot free-living1
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions87 of 200 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Saint Louis, US | 420 |
| Durango, MX | 214 |
| Mexico City, MX | 159 |
| Bronx, US | 155 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 110 |
| Chicago, US | 93 |
| Mexico City, MX | 85 |
| University of Stellenboschlocation not on record | 76 |
| Sociedad para el Estudio de los Recursos Bióticos de Oaxaca, A. C.location not on record | 52 |
| Kew, GB | 48 |
| Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record | 43 |
| Austin, US | 42 |
| Fundación Miguel Lillolocation not on record | 39 |
| San Isidro, AR | 38 |
| National Biodiversity Institute, Costa Ricalocation not on record | 35 |
| JBRJlocation not on record | 34 |
| UFRPElocation not on record | 27 |
| León, NI | 25 |
| Blumenau, BR | 25 |
| Riverside, US | 23 |
| Tapachula, MX | 22 |
| Chapingo, MX | 22 |
| Mérida, MX | 22 |
| UnBlocation not on record | 19 |
| Museo Nacional de Costa Rica (MNCR)location not on record | 19 |
| St. Augustine, TT | 19 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 18 |
| Chaguaramas, TT | 16 |
| UTFPR-CPlocation not on record | 16 |
| UNICAMPlocation not on record | 15 |
| Centro de Estudios y Colecciones Biológicas para la Conservaciónlocation not on record | 15 |
| FUVATESlocation not on record | 15 |
| Ciudad de México, MX | 15 |
| INBIOlocation not on record | 13 |
| Campo Mourão, BR | 13 |
| Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record | 13 |
| Santa Cruz de la Sierra, BO | 13 |
| Tuxtla Gutiérrez, MX | 13 |
| Tuxtla Gutiérrez, MX | 12 |
| Autlán de Navarro, MX | 12 |
| Cenargenlocation not on record | 12 |
| Brasília, BR | 12 |
| Laboratorio de Ictiologialocation not on record | 11 |
| Corrientes, AR | 10 |
| Antiguo Cuscatlán, SV | 10 |
| South Kensington, GB | 10 |
| UEMlocation not on record | 10 |
| Mexico City, MX | 10 |
| Maringá, BR | 10 |
| Masindi, UG | 9 |
| Departamento de Sistematica e Ecologialocation not on record | 9 |
| Austin, US | 9 |
| Brasília, BR | 9 |
| Istituto Agrario Castelnuovolocation not on record | 9 |
| CEPLAClocation not on record | 9 |
| MAlocation not on record | 8 |
| La Paz, BO | 8 |
| Ivano-Frankivsk, UA | 8 |
| Altos de Pipe, VE | 8 |
| Universidad de Antioquia (UdeA)location not on record | 7 |
| MEXUlocation not on record | 7 |
| IAvHlocation not on record | 7 |
| Universidade Federale do Rio Grande do Sullocation not on record | 7 |
| UFBAlocation not on record | 7 |
| ASUlocation not on record | 7 |
| Durban, ZA | 7 |
| University of Leicesterlocation not on record | 6 |
| Salvador, BR | 6 |
| Teresina, BR | 6 |
| UFPIlocation not on record | 6 |
| Universidade Federal de Sergipe (UFS)location not on record | 6 |
| Jardín Botánico de Cartagena "Guillermo Piñeres" (JBC)location not on record | 6 |
| Feira de Santana, BR | 5 |
| UEPAlocation not on record | 5 |
| CASlocation not on record | 5 |
| Mazatlán, MX | 5 |
| San José, CR | 5 |
| Berlin, DE | 5 |
| Santa Teresa, BR | 5 |
| UNESP-RClocation not on record | 5 |
| PUC-RSlocation not on record | 5 |
| INMAlocation not on record | 5 |
| Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record | 5 |
| Cuiabá, BR | 5 |
| Foz do Iguaçu, BR | 4 |
| Universidade de São Paulolocation not on record | 4 |
| Museu Paraense Emílio Goeldilocation not on record | 4 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 4 |
| Lake Charles, US | 4 |
| HACAMlocation not on record | 4 |
| USP-IBlocation not on record | 4 |
| Córdoba, AR | 4 |
| BMlocation not on record | 4 |
| Tampa, US | 4 |
| Londrina, BR | 4 |
| Guatemala City, GT | 4 |
| Paleontological Collectionlocation not on record | 4 |
| Giardini Botanici Hanburylocation not on record | 3 |
| Universiti Sains Malaysialocation not on record | 3 |
| Glocation not on record | 3 |
| Fort Worth, US | 3 |
| Phoenix, US | 3 |
| VALElocation not on record | 3 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 3 |
| Universidad Nacional de Colombia (UNAL)location not on record | 3 |
| UDESC-CAVlocation not on record | 3 |
| Stockholm, SE | 3 |
| UFMGlocation not on record | 3 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 3 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 3 |
| Universidade Federal do Rio Grande do Nortelocation not on record | 3 |
| Universidad Nacional de Asunciónlocation not on record | 3 |
| Pontifícia Universidade Católica do Paranálocation not on record | 3 |
| IPA/SPlocation not on record | 2 |
| UNESClocation not on record | 2 |
| Universidade Federal de Santa Catarinalocation not on record | 2 |
| Criciúma, BR | 2 |
| San Diego, US | 2 |
| Tlalnepantla, MX | 2 |
| HUT Culture Collectionlocation not on record | 2 |
| Universidad Distrital Francisco José de Caldas (UDistrital)location not on record | 2 |
| UNIVASFlocation not on record | 2 |
| FPMZBlocation not on record | 2 |
| San Francisco, US | 2 |
| M-VascularPlantslocation not on record | 2 |
| Museum of Zoologylocation not on record | 2 |
| UNESP, Campus São José Rio Prêtolocation not on record | 2 |
| Miami, US | 2 |
| Bogotá, D.C., CO | 2 |
| IAPlocation not on record | 2 |
| UFSClocation not on record | 2 |
| Edinburgh, GB | 2 |
| Fortaleza, BR | 2 |
| QCNElocation not on record | 2 |
| CJBGlocation not on record | 2 |
| Dover, US | 2 |
| Universidad Nacional Agrarialocation not on record | 2 |
| Jataí / Setor Industrial, BR | 2 |
| UFMSlocation not on record | 2 |
| Castelar, AR | 2 |
| Universidade Federal do Espírito Santolocation not on record | 1 |
| UNESP-FCAlocation not on record | 1 |
| Rotorua, NZ | 1 |
| PUC-RIOlocation not on record | 1 |
| Guasave, MX | 1 |
| FLASlocation not on record | 1 |
| Museo de Historia Natural de El Salvadorlocation not on record | 1 |
| Calabar, NG | 1 |
| Iquitos, PE | 1 |
| Universidad de La Salle (La Salle)location not on record | 1 |
| UFPElocation not on record | 1 |
| Jardín Botánico de Cartagena “Guillermo Piñeres”location not on record | 1 |
| Universidad Nacional de Misiones- CONICETlocation not on record | 1 |
| Salamanca, ES | 1 |
| Cambridge, US | 1 |
| UFSMlocation not on record | 1 |
| Institut de Biologia Evolutiva, (CSIC-UPF)location not on record | 1 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 1 |
| ESALQlocation not on record | 1 |
| Cochabamba, BO | 1 |
| Los Angeles, US | 1 |
| Lima, PE | 1 |
| San Luis Potosí, MX | 1 |
| HUAlocation not on record | 1 |
| Universidade Federal de Mato Grosso do Sul, Campus do Pantanallocation not on record | 1 |
| HEMlocation not on record | 1 |
| UNIVILLElocation not on record | 1 |
| Tuscaloosa, US | 1 |
| FUNEDlocation not on record | 1 |
| UESBlocation not on record | 1 |
| HUENFlocation not on record | 1 |
| Chongqing Museumlocation not on record | 1 |
| Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record | 1 |
| UTFPR-SLlocation not on record | 1 |
| Frankfurt am Main | 1 |
| San Francisco de Campeche, MX | 1 |
| UFPRlocation not on record | 1 |
| Burlington, US | 1 |
| Wuzhou, CN | 1 |
| Davis, US | 1 |
| Ann Arbor, US | 1 |
| Cusco, PE | 1 |
| Museo naturalistico del Frignano Ferruccio Minghellilocation not on record | 1 |
| Zapopan, MX | 1 |
| Pondicherry, IN | 1 |
| Universidad de los Andes (UniAndes)location not on record | 1 |
| Universidad Nacional Federico Villarreallocation not on record | 1 |
| Santa Maria, BR | 1 |
| Paris, FR | 1 |
| Sangmiung Universitylocation not on record | 1 |
| Universidad del Tolima (UT)location not on record | 1 |
| Wlocation not on record | 1 |
| UNESP-IBILCElocation not on record | 1 |
| UNICENTRO-IRATIlocation not on record | 1 |
| UEMAlocation not on record | 1 |
| BAYLUlocation not on record | 1 |
| Universidade Federal do Vale do São Franciscolocation not on record | 1 |
| Universidad de Caldas (UCaldas)location not on record | 1 |
| Universidade Federal do Maranhãolocation not on record | 1 |
| Cambridge, US | 1 |
200 institutions · 2 605 of 2 641 vouchered records shown · 36 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.